Incidental Mutation 'R1393:Olfr811'
ID162704
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129801932 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 198 (F198L)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably benign
Transcript: ENSMUST00000076437
AA Change: F198L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: F198L

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215058
AA Change: F198L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably benign
Transcript: ENSMUST00000217571
AA Change: F198L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R0704:Olfr811 UTSW 10 129802303 missense probably benign 0.01
R1941:Olfr811 UTSW 10 129802412 missense probably benign 0.00
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R5750:Olfr811 UTSW 10 129801620 missense probably benign 0.01
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6109:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6440:Olfr811 UTSW 10 129801968 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
R8024:Olfr811 UTSW 10 129801943 missense probably damaging 1.00
Z1177:Olfr811 UTSW 10 129802309 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAAGTGTTGAGCACTGCTACACC -3'
(R):5'- AAAGTGTGCCACCAACTGGTCCTC -3'

Sequencing Primer
(F):5'- GCACTGCTACACCTTTATTTAAAGTC -3'
(R):5'- CTCAGCTCCTGGGTAACTG -3'
Posted On2014-03-17