Incidental Mutation 'R1393:Chad'
ID162705
Institutional Source Beutler Lab
Gene Symbol Chad
Ensembl Gene ENSMUSG00000039084
Gene Namechondroadherin
SynonymsSLRR4A
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1393 (G1)
Quality Score208
Status Not validated
Chromosome11
Chromosomal Location94565047-94569127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94565314 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 73 (M73L)
Ref Sequence ENSEMBL: ENSMUSP00000047844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040418] [ENSMUST00000103164]
Predicted Effect probably benign
Transcript: ENSMUST00000040418
AA Change: M73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047844
Gene: ENSMUSG00000039084
AA Change: M73L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 21 54 1.7e-7 SMART
LRR_TYP 73 96 9.58e-3 SMART
LRR_TYP 97 120 1.45e-2 SMART
LRR_TYP 121 144 1.69e-3 SMART
LRR_TYP 145 168 6.42e-4 SMART
LRR 170 192 2.2e1 SMART
LRR 193 216 2.14e1 SMART
LRR_TYP 217 240 4.17e-3 SMART
LRR 245 265 2.27e2 SMART
LRR 266 289 3.36e1 SMART
LRRCT 299 346 1.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103164
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155122
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroadherin is a cartilage matrix protein thought to mediate adhesion of isolated chondrocytes. The protein contains 11 leucine-rich repeats flanked by cysteine-rich regions. The chondroadherin messenger RNA is present in chondrocytes at all ages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit widened epiphyseal growth plate, abnormal tracbecular and cortical bone morphology and lower femoral neck failure load and tibial strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Chad
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1480:Chad UTSW 11 94565137 intron probably benign
R1855:Chad UTSW 11 94565477 missense probably damaging 1.00
R1924:Chad UTSW 11 94565558 missense possibly damaging 0.59
R2115:Chad UTSW 11 94568226 missense probably benign 0.01
R2255:Chad UTSW 11 94565697 missense possibly damaging 0.82
R4418:Chad UTSW 11 94567837 missense possibly damaging 0.90
R4847:Chad UTSW 11 94568327 missense probably benign 0.00
R4948:Chad UTSW 11 94565702 missense probably damaging 1.00
R5441:Chad UTSW 11 94568292 missense probably benign 0.01
R5511:Chad UTSW 11 94565246 missense probably damaging 1.00
R6387:Chad UTSW 11 94567837 missense possibly damaging 0.90
R6528:Chad UTSW 11 94565624 missense probably damaging 1.00
R7751:Chad UTSW 11 94565173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAAATCAGTGGCTTCGGTGCTC -3'
(R):5'- AGCACGCAGCTCTCGGATTTTG -3'

Sequencing Primer
(F):5'- TCAAGGCTGCCCTATAAATGG -3'
(R):5'- GGGCAGTTCCGACACTTTG -3'
Posted On2014-03-17