Incidental Mutation 'R1393:Spock1'
ID162711
Institutional Source Beutler Lab
Gene Symbol Spock1
Ensembl Gene ENSMUSG00000056222
Gene Namesparc/osteonectin, cwcv and kazal-like domains proteoglycan 1
Synonymstestican 1, Ticn1
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1393 (G1)
Quality Score118
Status Not validated
Chromosome13
Chromosomal Location57421195-57908332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57907454 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 45 (L45Q)
Ref Sequence ENSEMBL: ENSMUSP00000140409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172326] [ENSMUST00000185502] [ENSMUST00000185905] [ENSMUST00000186271] [ENSMUST00000187852] [ENSMUST00000189373]
Predicted Effect probably damaging
Transcript: ENSMUST00000172326
AA Change: L45Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128840
Gene: ENSMUSG00000056222
AA Change: L45Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 6e-35 PFAM
TY 334 380 9.64e-21 SMART
low complexity region 394 404 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185502
AA Change: L45Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140409
Gene: ENSMUSG00000056222
AA Change: L45Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 138 183 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 198 307 3.1e-33 PFAM
TY 337 383 9.64e-21 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185905
AA Change: L45Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000186271
AA Change: L45Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140755
Gene: ENSMUSG00000056222
AA Change: L45Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 3.1e-33 PFAM
TY 334 380 9.64e-21 SMART
low complexity region 394 404 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187852
AA Change: L45Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141130
Gene: ENSMUSG00000056222
AA Change: L45Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 2.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189373
AA Change: L45Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139863
Gene: ENSMUSG00000056222
AA Change: L45Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 138 183 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 198 307 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein core of a seminal plasma proteoglycan containing chondroitin- and heparan-sulfate chains. The protein's function is unknown, although similarity to thyropin-type cysteine protease-inhibitors suggests its function may be related to protease inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation display no obvious morphological or behavioral abnormalities, are fertile, and have normal life spans. Adult homozygotes exhibit normal brain morphology and EEG recordings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Spock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Spock1 APN 13 57587739 splice site probably benign
IGL00491:Spock1 APN 13 57556806 missense possibly damaging 0.67
IGL01942:Spock1 APN 13 57430328 missense probably damaging 1.00
IGL01998:Spock1 APN 13 57436181 splice site probably benign
IGL02428:Spock1 APN 13 57444432 splice site probably benign
IGL02805:Spock1 APN 13 57907577 missense possibly damaging 0.46
IGL02814:Spock1 APN 13 57587673 missense probably damaging 1.00
IGL03307:Spock1 APN 13 57429347 missense probably null 1.00
R0227:Spock1 UTSW 13 57440477 missense possibly damaging 0.86
R0243:Spock1 UTSW 13 57436109 critical splice donor site probably null
R0393:Spock1 UTSW 13 57440536 missense probably damaging 1.00
R1298:Spock1 UTSW 13 57512750 missense probably benign 0.00
R1467:Spock1 UTSW 13 57429369 missense possibly damaging 0.53
R1467:Spock1 UTSW 13 57429369 missense possibly damaging 0.53
R2134:Spock1 UTSW 13 57436139 missense probably damaging 0.99
R4386:Spock1 UTSW 13 57440450 missense probably damaging 1.00
R5524:Spock1 UTSW 13 57556795 missense probably damaging 1.00
R5765:Spock1 UTSW 13 57429404 missense probably benign 0.19
R7195:Spock1 UTSW 13 57907502 missense possibly damaging 0.92
R7446:Spock1 UTSW 13 57436085 missense unknown
R7701:Spock1 UTSW 13 57587659 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCACTGTGGACCTCCATGAGAG -3'
(R):5'- TCTTCAGTAGTTTGACGGCGGC -3'

Sequencing Primer
(F):5'- CCATGAGAGGTTTGAACCTACCA -3'
(R):5'- CTGTTTCCATGCATAAGGGC -3'
Posted On2014-03-17