Incidental Mutation 'R1393:Copz1'
ID162715
Institutional Source Beutler Lab
Gene Symbol Copz1
Ensembl Gene ENSMUSG00000060992
Gene Namecoatomer protein complex, subunit zeta 1
Synonyms5930435A22Rik, D4Ertd360e, nonclathrin coat protein zeta1-COP
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103272714-103299868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103294744 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 95 (N95S)
Ref Sequence ENSEMBL: ENSMUSP00000097738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100162] [ENSMUST00000229549] [ENSMUST00000230893]
Predicted Effect probably benign
Transcript: ENSMUST00000100162
AA Change: N95S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097738
Gene: ENSMUSG00000060992
AA Change: N95S

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 12 153 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230417
Predicted Effect probably benign
Transcript: ENSMUST00000230893
AA Change: N95S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the cytoplasmic coatamer protein complex, which is involved in autophagy and intracellular protein trafficking. The coatomer protein complex is comprised of seven subunits and functions as the coat protein of coat protein complex (COP)I-vesicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Copz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copz1 APN 15 103298749 utr 3 prime probably benign
IGL01732:Copz1 APN 15 103297891 missense probably benign 0.18
IGL03013:Copz1 APN 15 103296568 missense probably benign 0.41
R0539:Copz1 UTSW 15 103291365 missense probably damaging 1.00
R0684:Copz1 UTSW 15 103296531 critical splice acceptor site probably null
R4928:Copz1 UTSW 15 103291330 missense probably damaging 0.96
R5935:Copz1 UTSW 15 103294770 missense probably benign
R7493:Copz1 UTSW 15 103296544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAGCCAGAGTCCTTCTGCTG -3'
(R):5'- GCATCTGATATGCTCTGCTCCCAAC -3'

Sequencing Primer
(F):5'- CAGAGTCCTTCTGCTGTTGTG -3'
(R):5'- ttctttctttcttttttttttCCCCC -3'
Posted On2014-03-17