Incidental Mutation 'R1393:Abcf3'
ID162716
Institutional Source Beutler Lab
Gene Symbol Abcf3
Ensembl Gene ENSMUSG00000003234
Gene NameATP-binding cassette, sub-family F (GCN20), member 3
Synonyms
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20548577-20561379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20560430 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 682 (N682S)
Ref Sequence ENSEMBL: ENSMUSP00000003319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003319] [ENSMUST00000148679] [ENSMUST00000232680]
Predicted Effect probably benign
Transcript: ENSMUST00000003319
AA Change: N682S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000003319
Gene: ENSMUSG00000003234
AA Change: N682S

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
AAA 202 401 3.23e-11 SMART
low complexity region 423 435 N/A INTRINSIC
low complexity region 457 469 N/A INTRINSIC
AAA 517 684 4.68e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135861
Predicted Effect probably benign
Transcript: ENSMUST00000148679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154660
Predicted Effect probably benign
Transcript: ENSMUST00000231258
Predicted Effect probably benign
Transcript: ENSMUST00000232680
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Abcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Abcf3 APN 16 20551684 missense probably damaging 0.98
IGL01570:Abcf3 APN 16 20559998 missense probably damaging 1.00
IGL02239:Abcf3 APN 16 20550636 missense possibly damaging 0.85
R0158:Abcf3 UTSW 16 20552566 missense probably damaging 1.00
R0270:Abcf3 UTSW 16 20560168 splice site probably null
R0579:Abcf3 UTSW 16 20550648 missense probably benign
R0671:Abcf3 UTSW 16 20550487 missense probably damaging 1.00
R0799:Abcf3 UTSW 16 20559334 missense probably damaging 1.00
R1384:Abcf3 UTSW 16 20559303 missense probably damaging 1.00
R2356:Abcf3 UTSW 16 20560499 missense probably benign 0.01
R2910:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R2911:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R3081:Abcf3 UTSW 16 20559364 missense probably benign 0.09
R3852:Abcf3 UTSW 16 20560439 missense probably damaging 1.00
R4707:Abcf3 UTSW 16 20549058 missense possibly damaging 0.91
R4752:Abcf3 UTSW 16 20550576 missense probably damaging 1.00
R4885:Abcf3 UTSW 16 20551675 missense probably benign 0.05
R5672:Abcf3 UTSW 16 20549252 missense probably benign 0.00
R5817:Abcf3 UTSW 16 20549083 missense possibly damaging 0.95
R6013:Abcf3 UTSW 16 20550561 unclassified probably null
R6019:Abcf3 UTSW 16 20552451 missense possibly damaging 0.60
R6026:Abcf3 UTSW 16 20550570 missense probably damaging 1.00
R6952:Abcf3 UTSW 16 20549734 splice site probably null
R7327:Abcf3 UTSW 16 20548680 missense probably benign 0.03
R7431:Abcf3 UTSW 16 20558789 missense probably benign 0.00
R7539:Abcf3 UTSW 16 20552632 critical splice donor site probably null
R7764:Abcf3 UTSW 16 20549290 missense probably benign 0.36
X0066:Abcf3 UTSW 16 20559697 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CACCTGGACATGGAGACCATTGAAG -3'
(R):5'- TCCCCAAGTAGGGAAAGTCCTAAGC -3'

Sequencing Primer
(F):5'- TTTGGGCCAGGCTCTCAAC -3'
(R):5'- AGCTTGGAGTTGGTTGCCTAC -3'
Posted On2014-03-17