Incidental Mutation 'R1394:Gm597'
ID 162719
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission 039456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R1394 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28776809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 714 (E714G)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect possibly damaging
Transcript: ENSMUST00000059937
AA Change: E714G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: E714G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Casd1 T G 6: 4,624,117 C303W probably damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Cep290 T C 10: 100,537,529 S1224P possibly damaging Het
Col5a2 A G 1: 45,403,419 probably null Het
Cwc22 G A 2: 77,929,479 R75C possibly damaging Het
Cyp4a30b A T 4: 115,470,892 probably null Het
Dnah11 T C 12: 117,972,364 D3298G possibly damaging Het
Drc3 T C 11: 60,393,719 I450T possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fkbp15 T A 4: 62,327,872 M440L probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Ipp T A 4: 116,537,912 L548* probably null Het
Itm2a C T X: 107,398,201 V200I possibly damaging Het
Kank1 A G 19: 25,428,164 N1182S probably damaging Het
Mkks C T 2: 136,880,962 G92S probably damaging Het
Mybbp1a C T 11: 72,443,648 P243L probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Pcdh12 A G 18: 38,281,189 probably null Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Phlpp2 T A 8: 109,877,030 C109* probably null Het
Prickle2 T A 6: 92,376,382 H701L possibly damaging Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Psg19 T C 7: 18,797,058 N57S probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Scyl2 T A 10: 89,640,965 K766M possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Spin1 T C 13: 51,144,481 Y179H probably damaging Het
Tecpr1 T C 5: 144,206,539 T673A possibly damaging Het
Tenm3 T A 8: 48,276,400 M1508L probably benign Het
Vasn C T 16: 4,649,712 R508* probably null Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfand1 G T 3: 10,346,209 T62K probably benign Het
Zfy1 C T Y: 725,957 V603I possibly damaging Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACCGGACTGCTGCTTGTTACCATC -3'
(R):5'- ACAAGACCAGGCCCAGAATACTGTG -3'

Sequencing Primer
(F):5'- CTCCTCTGTAACTACAAGGATAGTC -3'
(R):5'- TTTGAAACGTGGAGGCATAAACTC -3'
Posted On 2014-03-17