Incidental Mutation 'R1394:Gtf3c3'
ID162722
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 039456-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1394 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54417778 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 488 (A488T)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably damaging
Transcript: ENSMUST00000041638
AA Change: A488T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: A488T

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190419
Meta Mutation Damage Score 0.6542 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Casd1 T G 6: 4,624,117 C303W probably damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Cep290 T C 10: 100,537,529 S1224P possibly damaging Het
Col5a2 A G 1: 45,403,419 probably null Het
Cwc22 G A 2: 77,929,479 R75C possibly damaging Het
Cyp4a30b A T 4: 115,470,892 probably null Het
Dnah11 T C 12: 117,972,364 D3298G possibly damaging Het
Drc3 T C 11: 60,393,719 I450T possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fkbp15 T A 4: 62,327,872 M440L probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Ipp T A 4: 116,537,912 L548* probably null Het
Itm2a C T X: 107,398,201 V200I possibly damaging Het
Kank1 A G 19: 25,428,164 N1182S probably damaging Het
Mkks C T 2: 136,880,962 G92S probably damaging Het
Mybbp1a C T 11: 72,443,648 P243L probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Pcdh12 A G 18: 38,281,189 probably null Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Phlpp2 T A 8: 109,877,030 C109* probably null Het
Prickle2 T A 6: 92,376,382 H701L possibly damaging Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Psg19 T C 7: 18,797,058 N57S probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Scyl2 T A 10: 89,640,965 K766M possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Spin1 T C 13: 51,144,481 Y179H probably damaging Het
Tecpr1 T C 5: 144,206,539 T673A possibly damaging Het
Tenm3 T A 8: 48,276,400 M1508L probably benign Het
Vasn C T 16: 4,649,712 R508* probably null Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfand1 G T 3: 10,346,209 T62K probably benign Het
Zfy1 C T Y: 725,957 V603I possibly damaging Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 splice site probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
R7586:Gtf3c3 UTSW 1 54403593 missense probably damaging 1.00
R7615:Gtf3c3 UTSW 1 54423572 missense possibly damaging 0.49
R7634:Gtf3c3 UTSW 1 54419641 splice site probably null
R7739:Gtf3c3 UTSW 1 54405039 missense possibly damaging 0.94
R8349:Gtf3c3 UTSW 1 54428909 missense probably damaging 1.00
R8449:Gtf3c3 UTSW 1 54428909 missense probably damaging 1.00
R8755:Gtf3c3 UTSW 1 54428872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATCTGCCATGCAAGCCTAAAGAC -3'
(R):5'- AGGATTGCAAATCAGTGAGGCTGTG -3'

Sequencing Primer
(F):5'- gaaggaccctgatgctcac -3'
(R):5'- TCAGTGAGGCTGTGTCATAAAG -3'
Posted On2014-03-17