Mutagenetix > Incidental Mutation

Incidental Mutation 'R1394:Tecpr1'

162740

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

039456-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1394 (G1)

Quality Score

202

Status

Not validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144206539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 673 (T673A)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085701
AA Change: T673A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: T673A

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153751

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,101,496	Y122H	probably damaging	Het
Ankrd27	T	C	7: 35,615,869	F481S	possibly damaging	Het
Casd1	T	G	6: 4,624,117	C303W	probably damaging	Het
Cep128	C	T	12: 91,266,980	R438Q	probably benign	Het
Cep192	A	G	18: 67,858,921	T1957A	probably damaging	Het
Cep290	T	C	10: 100,537,529	S1224P	possibly damaging	Het
Col5a2	A	G	1: 45,403,419		probably null	Het
Cwc22	G	A	2: 77,929,479	R75C	possibly damaging	Het
Cyp4a30b	A	T	4: 115,470,892		probably null	Het
Dnah11	T	C	12: 117,972,364	D3298G	possibly damaging	Het
Drc3	T	C	11: 60,393,719	I450T	possibly damaging	Het
Dst	T	C	1: 34,165,155		probably null	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Emilin2	G	T	17: 71,253,071	D970E	possibly damaging	Het
Fcgbp	A	G	7: 28,093,379	H936R	probably damaging	Het
Fkbp15	T	A	4: 62,327,872	M440L	probably benign	Het
Fryl	T	C	5: 73,072,912	H1634R	probably damaging	Het
Gm44511	G	A	6: 128,820,330	S32L	possibly damaging	Het
Gm597	T	C	1: 28,776,809	E714G	possibly damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Ift81	G	T	5: 122,568,923	D485E	probably benign	Het
Ipp	T	A	4: 116,537,912	L548*	probably null	Het
Itm2a	C	T	X: 107,398,201	V200I	possibly damaging	Het
Kank1	A	G	19: 25,428,164	N1182S	probably damaging	Het
Mkks	C	T	2: 136,880,962	G92S	probably damaging	Het
Mybbp1a	C	T	11: 72,443,648	P243L	probably damaging	Het
Myo1f	A	G	17: 33,583,740	D386G	probably damaging	Het
Obsl1	T	C	1: 75,492,665	S109G	probably damaging	Het
Olfr12	T	A	1: 92,620,545	I213N	probably benign	Het
Olfr1347	T	A	7: 6,488,362	T171S	probably damaging	Het
Pcdh12	A	G	18: 38,281,189		probably null	Het
Phlpp1	T	C	1: 106,350,618	V920A	possibly damaging	Het
Phlpp2	T	A	8: 109,877,030	C109*	probably null	Het
Prickle2	T	A	6: 92,376,382	H701L	possibly damaging	Het
Psen1	G	A	12: 83,724,572	G209R	probably damaging	Het
Psg19	T	C	7: 18,797,058	N57S	probably damaging	Het
Rdh12	A	G	12: 79,209,065	T9A	probably benign	Het
Rgma	G	T	7: 73,417,794	A360S	probably benign	Het
Scyl2	T	A	10: 89,640,965	K766M	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Spata46	A	G	1: 170,312,004	T191A	probably benign	Het
Spin1	T	C	13: 51,144,481	Y179H	probably damaging	Het
Tenm3	T	A	8: 48,276,400	M1508L	probably benign	Het
Vasn	C	T	16: 4,649,712	R508*	probably null	Het
Vmn2r15	T	A	5: 109,294,148	I140L	probably benign	Het
Wdr44	T	G	X: 23,796,059	C645G	probably damaging	Het
Zfand1	G	T	3: 10,346,209	T62K	probably benign	Het
Zfy1	C	T	Y: 725,957	V603I	possibly damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCTTCTCGCTAAGCCCATGAGGAC -3'
(R):5'- ATGTGTGCCAGGCATTCAACTCCC -3'

Sequencing Primer
(F):5'- TGAGGACCCCCGATCACTC -3'
(R):5'- gagacaggctctcatgcac -3'

Posted On

2014-03-17