Incidental Mutation 'R1394:Phlpp2'
ID 162751
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission 039456-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R1394 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 110595174-110671303 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 110603662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 109 (C109*)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect probably null
Transcript: ENSMUST00000034175
AA Change: C74*
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: C74*

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154262
Predicted Effect probably null
Transcript: ENSMUST00000179721
AA Change: C109*
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: C109*

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,249,362 (GRCm39) Y122H probably damaging Het
Ankrd27 T C 7: 35,315,294 (GRCm39) F481S possibly damaging Het
Casd1 T G 6: 4,624,117 (GRCm39) C303W probably damaging Het
Cep128 C T 12: 91,233,754 (GRCm39) R438Q probably benign Het
Cep192 A G 18: 67,991,992 (GRCm39) T1957A probably damaging Het
Cep290 T C 10: 100,373,391 (GRCm39) S1224P possibly damaging Het
Col5a2 A G 1: 45,442,579 (GRCm39) probably null Het
Cwc22 G A 2: 77,759,823 (GRCm39) R75C possibly damaging Het
Cyp4a30b A T 4: 115,328,089 (GRCm39) probably null Het
Dnah11 T C 12: 117,936,099 (GRCm39) D3298G possibly damaging Het
Drc3 T C 11: 60,284,545 (GRCm39) I450T possibly damaging Het
Dst T C 1: 34,204,236 (GRCm39) probably null Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Emilin2 G T 17: 71,560,066 (GRCm39) D970E possibly damaging Het
Fcgbp A G 7: 27,792,804 (GRCm39) H936R probably damaging Het
Fkbp15 T A 4: 62,246,109 (GRCm39) M440L probably benign Het
Fryl T C 5: 73,230,255 (GRCm39) H1634R probably damaging Het
Gm44511 G A 6: 128,797,293 (GRCm39) S32L possibly damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Ift81 G T 5: 122,706,986 (GRCm39) D485E probably benign Het
Ipp T A 4: 116,395,109 (GRCm39) L548* probably null Het
Itm2a C T X: 106,441,807 (GRCm39) V200I possibly damaging Het
Kank1 A G 19: 25,405,528 (GRCm39) N1182S probably damaging Het
Mkks C T 2: 136,722,882 (GRCm39) G92S probably damaging Het
Mybbp1a C T 11: 72,334,474 (GRCm39) P243L probably damaging Het
Myo1f A G 17: 33,802,714 (GRCm39) D386G probably damaging Het
Obsl1 T C 1: 75,469,309 (GRCm39) S109G probably damaging Het
Or6z6 T A 7: 6,491,361 (GRCm39) T171S probably damaging Het
Or9s13 T A 1: 92,548,267 (GRCm39) I213N probably benign Het
Pcdh12 A G 18: 38,414,242 (GRCm39) probably null Het
Phlpp1 T C 1: 106,278,348 (GRCm39) V920A possibly damaging Het
Prickle2 T A 6: 92,353,363 (GRCm39) H701L possibly damaging Het
Psen1 G A 12: 83,771,346 (GRCm39) G209R probably damaging Het
Psg19 T C 7: 18,530,983 (GRCm39) N57S probably damaging Het
Rdh12 A G 12: 79,255,839 (GRCm39) T9A probably benign Het
Rgma G T 7: 73,067,542 (GRCm39) A360S probably benign Het
Scyl2 T A 10: 89,476,827 (GRCm39) K766M possibly damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Spata31e5 T C 1: 28,815,890 (GRCm39) E714G possibly damaging Het
Spata46 A G 1: 170,139,573 (GRCm39) T191A probably benign Het
Spin1 T C 13: 51,298,517 (GRCm39) Y179H probably damaging Het
Tecpr1 T C 5: 144,143,357 (GRCm39) T673A possibly damaging Het
Tenm3 T A 8: 48,729,435 (GRCm39) M1508L probably benign Het
Vasn C T 16: 4,467,576 (GRCm39) R508* probably null Het
Vmn2r15 T A 5: 109,442,014 (GRCm39) I140L probably benign Het
Wdr44 T G X: 23,662,298 (GRCm39) C645G probably damaging Het
Zfand1 G T 3: 10,411,269 (GRCm39) T62K probably benign Het
Zfy1 C T Y: 725,957 (GRCm39) V603I possibly damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 110,652,422 (GRCm39) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 110,663,729 (GRCm39) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 110,660,697 (GRCm39) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 110,666,491 (GRCm39) missense probably benign
IGL02105:Phlpp2 APN 8 110,631,040 (GRCm39) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 110,646,731 (GRCm39) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 110,666,505 (GRCm39) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 110,640,250 (GRCm39) missense probably benign
IGL03356:Phlpp2 APN 8 110,662,249 (GRCm39) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 110,667,467 (GRCm39) missense probably benign 0.44
R0142:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 110,666,567 (GRCm39) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 110,655,095 (GRCm39) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 110,622,138 (GRCm39) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 110,603,603 (GRCm39) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 110,659,843 (GRCm39) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 110,622,219 (GRCm39) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R1417:Phlpp2 UTSW 8 110,667,313 (GRCm39) nonsense probably null
R1602:Phlpp2 UTSW 8 110,660,655 (GRCm39) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 110,660,587 (GRCm39) splice site probably benign
R1815:Phlpp2 UTSW 8 110,666,855 (GRCm39) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 110,634,232 (GRCm39) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 110,666,634 (GRCm39) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 110,634,245 (GRCm39) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 110,603,515 (GRCm39) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 110,667,452 (GRCm39) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 110,667,052 (GRCm39) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 110,603,642 (GRCm39) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 110,666,714 (GRCm39) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 110,640,251 (GRCm39) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 110,652,461 (GRCm39) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 110,660,667 (GRCm39) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 110,630,976 (GRCm39) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 110,655,205 (GRCm39) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 110,661,317 (GRCm39) missense probably benign
R6470:Phlpp2 UTSW 8 110,663,826 (GRCm39) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 110,655,197 (GRCm39) missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 110,603,486 (GRCm39) missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 110,666,585 (GRCm39) missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 110,666,820 (GRCm39) missense probably benign
R7312:Phlpp2 UTSW 8 110,666,785 (GRCm39) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 110,655,278 (GRCm39) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 110,652,474 (GRCm39) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 110,622,189 (GRCm39) missense probably benign 0.00
R8174:Phlpp2 UTSW 8 110,595,321 (GRCm39) missense unknown
R8242:Phlpp2 UTSW 8 110,666,834 (GRCm39) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 110,640,202 (GRCm39) missense probably benign
R8688:Phlpp2 UTSW 8 110,631,012 (GRCm39) missense probably damaging 1.00
R8843:Phlpp2 UTSW 8 110,652,431 (GRCm39) missense probably benign 0.18
R9154:Phlpp2 UTSW 8 110,666,590 (GRCm39) missense possibly damaging 0.82
R9556:Phlpp2 UTSW 8 110,666,758 (GRCm39) missense probably benign
R9737:Phlpp2 UTSW 8 110,663,714 (GRCm39) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 110,662,178 (GRCm39) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 110,660,655 (GRCm39) nonsense probably null
X0018:Phlpp2 UTSW 8 110,639,001 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACGGAACACATGCAATTCAGAC -3'
(R):5'- CTTGACATTAACCTCTGACCTACAGGC -3'

Sequencing Primer
(F):5'- ATAGAAGAAGTAGGTTTGGTTCCC -3'
(R):5'- tgcctaaaattctagcacttcag -3'
Posted On 2014-03-17