Mutagenetix > Incidental Mutation

Incidental Mutation 'R1394:Mybbp1a'

162755

Institutional Source

Beutler Lab

Gene Symbol

Mybbp1a

Ensembl Gene

ENSMUSG00000040463

Gene Name

MYB binding protein (P160) 1a

Synonyms

p160MBP, p67MBP

MMRRC Submission

039456-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1394 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72441355-72451768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 72443648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 243 (P243L)

Ref Sequence

ENSEMBL: ENSMUSP00000044827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045633]

AlphaFold

Q7TPV4

Predicted Effect

probably damaging
Transcript: ENSMUST00000045633
AA Change: P243L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: P243L

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
Pfam:DNA_pol_phi	70	835	1.2e-194	PFAM
low complexity region	839	852	N/A	INTRINSIC
low complexity region	1080	1090	N/A	INTRINSIC
low complexity region	1109	1122	N/A	INTRINSIC
low complexity region	1259	1269	N/A	INTRINSIC
low complexity region	1314	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134119

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144374

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152894

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156833

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162048

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,101,496	Y122H	probably damaging	Het
Ankrd27	T	C	7: 35,615,869	F481S	possibly damaging	Het
Casd1	T	G	6: 4,624,117	C303W	probably damaging	Het
Cep128	C	T	12: 91,266,980	R438Q	probably benign	Het
Cep192	A	G	18: 67,858,921	T1957A	probably damaging	Het
Cep290	T	C	10: 100,537,529	S1224P	possibly damaging	Het
Col5a2	A	G	1: 45,403,419		probably null	Het
Cwc22	G	A	2: 77,929,479	R75C	possibly damaging	Het
Cyp4a30b	A	T	4: 115,470,892		probably null	Het
Dnah11	T	C	12: 117,972,364	D3298G	possibly damaging	Het
Drc3	T	C	11: 60,393,719	I450T	possibly damaging	Het
Dst	T	C	1: 34,165,155		probably null	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Emilin2	G	T	17: 71,253,071	D970E	possibly damaging	Het
Fcgbp	A	G	7: 28,093,379	H936R	probably damaging	Het
Fkbp15	T	A	4: 62,327,872	M440L	probably benign	Het
Fryl	T	C	5: 73,072,912	H1634R	probably damaging	Het
Gm44511	G	A	6: 128,820,330	S32L	possibly damaging	Het
Gm597	T	C	1: 28,776,809	E714G	possibly damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Ift81	G	T	5: 122,568,923	D485E	probably benign	Het
Ipp	T	A	4: 116,537,912	L548*	probably null	Het
Itm2a	C	T	X: 107,398,201	V200I	possibly damaging	Het
Kank1	A	G	19: 25,428,164	N1182S	probably damaging	Het
Mkks	C	T	2: 136,880,962	G92S	probably damaging	Het
Myo1f	A	G	17: 33,583,740	D386G	probably damaging	Het
Obsl1	T	C	1: 75,492,665	S109G	probably damaging	Het
Olfr12	T	A	1: 92,620,545	I213N	probably benign	Het
Olfr1347	T	A	7: 6,488,362	T171S	probably damaging	Het
Pcdh12	A	G	18: 38,281,189		probably null	Het
Phlpp1	T	C	1: 106,350,618	V920A	possibly damaging	Het
Phlpp2	T	A	8: 109,877,030	C109*	probably null	Het
Prickle2	T	A	6: 92,376,382	H701L	possibly damaging	Het
Psen1	G	A	12: 83,724,572	G209R	probably damaging	Het
Psg19	T	C	7: 18,797,058	N57S	probably damaging	Het
Rdh12	A	G	12: 79,209,065	T9A	probably benign	Het
Rgma	G	T	7: 73,417,794	A360S	probably benign	Het
Scyl2	T	A	10: 89,640,965	K766M	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Spata46	A	G	1: 170,312,004	T191A	probably benign	Het
Spin1	T	C	13: 51,144,481	Y179H	probably damaging	Het
Tecpr1	T	C	5: 144,206,539	T673A	possibly damaging	Het
Tenm3	T	A	8: 48,276,400	M1508L	probably benign	Het
Vasn	C	T	16: 4,649,712	R508*	probably null	Het
Vmn2r15	T	A	5: 109,294,148	I140L	probably benign	Het
Wdr44	T	G	X: 23,796,059	C645G	probably damaging	Het
Zfand1	G	T	3: 10,346,209	T62K	probably benign	Het
Zfy1	C	T	Y: 725,957	V603I	possibly damaging	Het

Other mutations in Mybbp1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00924:Mybbp1a	APN	11	72443567	missense	probably damaging	1.00
IGL03240:Mybbp1a	APN	11	72445666	missense	possibly damaging	0.95
IGL03271:Mybbp1a	APN	11	72443918	splice site	probably benign
IGL03344:Mybbp1a	APN	11	72445202	missense	probably damaging	1.00
fratelli	UTSW	11	72445712	missense	probably benign	0.02
primi	UTSW	11	72442901	splice site	probably null
sorelli	UTSW	11	72447759	missense	possibly damaging	0.94
R0276:Mybbp1a	UTSW	11	72450107	splice site	probably null
R0437:Mybbp1a	UTSW	11	72448848	missense	possibly damaging	0.75
R0551:Mybbp1a	UTSW	11	72448376	missense	probably benign	0.06
R1667:Mybbp1a	UTSW	11	72445217	missense	probably benign	0.00
R1888:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1888:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1891:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R1894:Mybbp1a	UTSW	11	72446037	missense	probably benign	0.18
R2074:Mybbp1a	UTSW	11	72441445	missense	probably benign	0.01
R2257:Mybbp1a	UTSW	11	72446195	missense	probably benign	0.10
R3739:Mybbp1a	UTSW	11	72448737	missense	possibly damaging	0.77
R3983:Mybbp1a	UTSW	11	72447170	missense	probably damaging	1.00
R4191:Mybbp1a	UTSW	11	72451287	missense	probably damaging	0.97
R4660:Mybbp1a	UTSW	11	72445712	missense	probably benign	0.02
R4667:Mybbp1a	UTSW	11	72447971	missense	possibly damaging	0.94
R4769:Mybbp1a	UTSW	11	72445640	missense	probably damaging	1.00
R4982:Mybbp1a	UTSW	11	72445214	missense	probably damaging	0.99
R5451:Mybbp1a	UTSW	11	72448113	missense	probably damaging	0.99
R5514:Mybbp1a	UTSW	11	72450636	missense	possibly damaging	0.61
R5548:Mybbp1a	UTSW	11	72446172	missense	probably damaging	1.00
R5673:Mybbp1a	UTSW	11	72444925	missense	probably benign	0.30
R5947:Mybbp1a	UTSW	11	72442431	missense	probably damaging	1.00
R6161:Mybbp1a	UTSW	11	72446012	missense	probably damaging	1.00
R6785:Mybbp1a	UTSW	11	72447566	missense	probably benign	0.00
R7154:Mybbp1a	UTSW	11	72447642	splice site	probably null
R7227:Mybbp1a	UTSW	11	72447759	missense	possibly damaging	0.94
R7238:Mybbp1a	UTSW	11	72443512	missense	probably damaging	1.00
R7441:Mybbp1a	UTSW	11	72451275	missense	probably benign	0.01
R7833:Mybbp1a	UTSW	11	72442901	splice site	probably null
R8213:Mybbp1a	UTSW	11	72444721	missense	probably damaging	1.00
R8324:Mybbp1a	UTSW	11	72445288	critical splice donor site	probably null
R8474:Mybbp1a	UTSW	11	72447737	missense	probably benign	0.01
R8972:Mybbp1a	UTSW	11	72446250	missense	probably benign	0.35
R9018:Mybbp1a	UTSW	11	72443594	missense	probably benign	0.09
R9380:Mybbp1a	UTSW	11	72442842	missense	probably benign	0.24
R9505:Mybbp1a	UTSW	11	72449071	missense	probably benign	0.26
X0050:Mybbp1a	UTSW	11	72441677	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAGACCCCAGGCCAGTTAGTCATC -3'
(R):5'- ACATTAGGCAGCTTGTGCTCCTTC -3'

Sequencing Primer
(F):5'- ACTAGTGGTGTATCCGAAGCC -3'
(R):5'- CCTTCTTGACAGAGTTGGCG -3'

Posted On

2014-03-17