Incidental Mutation 'R1394:Spin1'
ID162762
Institutional Source Beutler Lab
Gene Symbol Spin1
Ensembl Gene ENSMUSG00000021395
Gene Namespindlin 1
SynonymsSpin
MMRRC Submission 039456-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1394 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location51100880-51152546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51144481 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 179 (Y179H)
Ref Sequence ENSEMBL: ENSMUSP00000093473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095797]
Predicted Effect probably damaging
Transcript: ENSMUST00000095797
AA Change: Y179H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093473
Gene: ENSMUSG00000021395
AA Change: Y179H

DomainStartEndE-ValueType
Pfam:Spin-Ssty 54 103 7.3e-30 PFAM
Pfam:Spin-Ssty 133 182 1.2e-26 PFAM
Pfam:Spin-Ssty 214 259 1.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223152
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display complete postnatal lethality. Although mutant female mice exhibit normal follicular development and oocyte growth, fully grown oocytes are defective in resuming meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Casd1 T G 6: 4,624,117 C303W probably damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Cep290 T C 10: 100,537,529 S1224P possibly damaging Het
Col5a2 A G 1: 45,403,419 probably null Het
Cwc22 G A 2: 77,929,479 R75C possibly damaging Het
Cyp4a30b A T 4: 115,470,892 probably null Het
Dnah11 T C 12: 117,972,364 D3298G possibly damaging Het
Drc3 T C 11: 60,393,719 I450T possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fkbp15 T A 4: 62,327,872 M440L probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Ipp T A 4: 116,537,912 L548* probably null Het
Itm2a C T X: 107,398,201 V200I possibly damaging Het
Kank1 A G 19: 25,428,164 N1182S probably damaging Het
Mkks C T 2: 136,880,962 G92S probably damaging Het
Mybbp1a C T 11: 72,443,648 P243L probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Pcdh12 A G 18: 38,281,189 probably null Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Phlpp2 T A 8: 109,877,030 C109* probably null Het
Prickle2 T A 6: 92,376,382 H701L possibly damaging Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Psg19 T C 7: 18,797,058 N57S probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Scyl2 T A 10: 89,640,965 K766M possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tecpr1 T C 5: 144,206,539 T673A possibly damaging Het
Tenm3 T A 8: 48,276,400 M1508L probably benign Het
Vasn C T 16: 4,649,712 R508* probably null Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfand1 G T 3: 10,346,209 T62K probably benign Het
Zfy1 C T Y: 725,957 V603I possibly damaging Het
Other mutations in Spin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Spin1 APN 13 51144541 splice site probably null
IGL02825:Spin1 APN 13 51123296 splice site probably benign
IGL03366:Spin1 APN 13 51127937 missense probably benign 0.03
R0050:Spin1 UTSW 13 51150418 utr 3 prime probably benign
R0139:Spin1 UTSW 13 51149012 missense probably benign 0.01
R0745:Spin1 UTSW 13 51139515 missense probably damaging 0.96
R1674:Spin1 UTSW 13 51149099 missense probably damaging 1.00
R1980:Spin1 UTSW 13 51144470 missense probably damaging 1.00
R2070:Spin1 UTSW 13 51144537 critical splice donor site probably null
R5326:Spin1 UTSW 13 51139527 missense probably damaging 1.00
R5741:Spin1 UTSW 13 51149135 missense possibly damaging 0.81
R6030:Spin1 UTSW 13 51139516 nonsense probably null
R6030:Spin1 UTSW 13 51139516 nonsense probably null
R6182:Spin1 UTSW 13 51144338 missense probably benign
R7423:Spin1 UTSW 13 51123290 critical splice donor site probably null
R7555:Spin1 UTSW 13 51149049 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCAGCGATGCACACTTAGCGGAC -3'
(R):5'- CCACACTTGCAATGGGAACAGCTAC -3'

Sequencing Primer
(F):5'- CTTAGCGGACACAATGATCGG -3'
(R):5'- ACGGATTCACTTTATTCCTACATGG -3'
Posted On2014-03-17