Incidental Mutation 'R1395:Fdxacb1'
ID162812
Institutional Source Beutler Lab
Gene Symbol Fdxacb1
Ensembl Gene ENSMUSG00000037845
Gene Nameferredoxin-fold anticodon binding domain containing 1
Synonyms
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1395 (G1)
Quality Score217
Status Validated
Chromosome9
Chromosomal Location50768236-50773348 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TAGAC to T at 50772496 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000042391] [ENSMUST00000042468] [ENSMUST00000159576] [ENSMUST00000162073] [ENSMUST00000176145] [ENSMUST00000176238] [ENSMUST00000176335] [ENSMUST00000177384] [ENSMUST00000177546]
Predicted Effect probably benign
Transcript: ENSMUST00000034561
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042391
SMART Domains Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 176 1.4e-44 PFAM
low complexity region 258 269 N/A INTRINSIC
SCOP:d1jjca_ 487 516 6e-4 SMART
FDX-ACB 528 622 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042468
SMART Domains Protein: ENSMUSP00000041803
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 149 7.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159576
SMART Domains Protein: ENSMUSP00000123711
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 228 1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162073
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162442
Predicted Effect probably benign
Transcript: ENSMUST00000176145
SMART Domains Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 115 4.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176160
Predicted Effect probably benign
Transcript: ENSMUST00000176238
SMART Domains Protein: ENSMUSP00000135679
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 70 4.2e-47 PFAM
Pfam:DUF1143 68 126 5.3e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176335
SMART Domains Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1jjca_ 285 314 3e-4 SMART
FDX-ACB 326 420 5.88e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177142
Predicted Effect probably benign
Transcript: ENSMUST00000177384
Predicted Effect probably benign
Transcript: ENSMUST00000177546
SMART Domains Protein: ENSMUSP00000134870
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 13 72 3.3e-39 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a ferredoxin-fold anticodon-binding domain which is contained in a subset of phenylalanyl tRNA synthetases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Fdxacb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Fdxacb1 APN 9 50771563 missense possibly damaging 0.75
IGL02828:Fdxacb1 APN 9 50771564 missense possibly damaging 0.75
IGL02799:Fdxacb1 UTSW 9 50772596 missense probably benign 0.01
R0755:Fdxacb1 UTSW 9 50771725 missense possibly damaging 0.87
R1283:Fdxacb1 UTSW 9 50768694 missense possibly damaging 0.79
R1991:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2103:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2273:Fdxacb1 UTSW 9 50772021 missense probably benign 0.01
R2913:Fdxacb1 UTSW 9 50768399 missense probably benign 0.05
R2914:Fdxacb1 UTSW 9 50768399 missense probably benign 0.05
R4289:Fdxacb1 UTSW 9 50772579 missense probably damaging 0.99
R4492:Fdxacb1 UTSW 9 50770247 missense probably damaging 0.99
R4668:Fdxacb1 UTSW 9 50770260 missense possibly damaging 0.74
R4742:Fdxacb1 UTSW 9 50768668 unclassified probably benign
R4789:Fdxacb1 UTSW 9 50770118 missense possibly damaging 0.84
R4935:Fdxacb1 UTSW 9 50771943 missense probably benign 0.00
R5190:Fdxacb1 UTSW 9 50772087 missense possibly damaging 0.78
R5652:Fdxacb1 UTSW 9 50768405 missense probably damaging 1.00
R6130:Fdxacb1 UTSW 9 50772602 nonsense probably null
R7483:Fdxacb1 UTSW 9 50770151 missense possibly damaging 0.89
R7487:Fdxacb1 UTSW 9 50770219 missense possibly damaging 0.88
R7571:Fdxacb1 UTSW 9 50771793 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGTTTCCTGAAGAGATTTGCCCCTG -3'
(R):5'- GGCCATCAACACTACTTGGGTCAC -3'

Sequencing Primer
(F):5'- TTTGCCCCTGGGAAAATAGAAC -3'
(R):5'- TGGGTCACACACacaaaaaaaaaaac -3'
Posted On2014-03-17