Incidental Mutation 'R1395:Prrxl1'
ID162830
Institutional Source Beutler Lab
Gene Symbol Prrxl1
Ensembl Gene ENSMUSG00000041730
Gene Namepaired related homeobox protein-like 1
SynonymsDrg11
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32599407-32649246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32608369 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 148 (P148S)
Ref Sequence ENSEMBL: ENSMUSP00000140337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068938] [ENSMUST00000186452] [ENSMUST00000187377] [ENSMUST00000189022] [ENSMUST00000228878]
Predicted Effect probably benign
Transcript: ENSMUST00000068938
AA Change: P148S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064107
Gene: ENSMUSG00000041730
AA Change: P148S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186452
AA Change: P148S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139756
Gene: ENSMUSG00000041730
AA Change: P148S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187377
AA Change: P148S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140687
Gene: ENSMUSG00000041730
AA Change: P148S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189022
AA Change: P148S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140337
Gene: ENSMUSG00000041730
AA Change: P148S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228878
AA Change: P148S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype PHENOTYPE: Homozygous null mice had delayed projection of sensory afferent neurons in the dorsal, but not the ventral, spinal cord during embryonic development. This delayed development resulted in abnormal responses to noxious stimuli in adults, but normal locomotion and sensory motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Prrxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Prrxl1 APN 14 32605214 splice site probably benign
IGL01868:Prrxl1 APN 14 32608377 missense probably damaging 0.99
R0436:Prrxl1 UTSW 14 32608083 missense probably damaging 1.00
R1574:Prrxl1 UTSW 14 32605324 splice site probably benign
R2093:Prrxl1 UTSW 14 32647155 intron probably benign
R3700:Prrxl1 UTSW 14 32628861 missense probably damaging 1.00
R4922:Prrxl1 UTSW 14 32608406 missense probably damaging 1.00
R4944:Prrxl1 UTSW 14 32608249 missense probably damaging 1.00
R4962:Prrxl1 UTSW 14 32647144 intron probably benign
R5512:Prrxl1 UTSW 14 32600044 missense probably damaging 0.99
R5989:Prrxl1 UTSW 14 32608188 missense probably benign 0.01
R7423:Prrxl1 UTSW 14 32628821 missense probably damaging 1.00
R7790:Prrxl1 UTSW 14 32628888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTGAGGAACATCAACTCTCC -3'
(R):5'- GGGCTGCCTCTAAGAAAAGCTCTG -3'

Sequencing Primer
(F):5'- TCAACTCTCCACCCCCAGG -3'
(R):5'- CCTCTAAGAAAAGCTCTGGGTTG -3'
Posted On2014-03-17