Incidental Mutation 'R1395:Myo1f'
ID162833
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Namemyosin IF
SynonymsC330006B10Rik
MMRRC Submission 039457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1395 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33555719-33607764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33583740 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 386 (D386G)
Ref Sequence ENSEMBL: ENSMUSP00000134715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372]
Predicted Effect probably damaging
Transcript: ENSMUST00000087605
AA Change: D386G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: D386G

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173372
AA Change: D386G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: D386G

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173426
Meta Mutation Damage Score 0.9657 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
4932431P20Rik T A 7: 29,531,387 noncoding transcript Het
A330070K13Rik A G 5: 130,379,141 probably benign Het
Abcc2 A G 19: 43,833,940 R1406G probably benign Het
Adgrv1 G T 13: 81,386,788 T5786K probably benign Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Arhgap11a C T 2: 113,833,122 V939I probably benign Het
Arhgap12 T C 18: 6,037,058 N561S probably benign Het
Arhgef12 T C 9: 43,005,870 H391R probably damaging Het
Asb3 T C 11: 31,101,032 probably benign Het
C2cd5 T C 6: 143,061,738 probably benign Het
Ccdc85a T C 11: 28,583,412 K44R possibly damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Col20a1 T A 2: 180,998,607 V519E probably damaging Het
Cylc2 A G 4: 51,228,366 K146E possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Eef1a1 C T 9: 78,479,018 V402I probably benign Het
Esyt3 T C 9: 99,316,782 probably benign Het
Extl3 A G 14: 65,077,496 V79A possibly damaging Het
Fat3 C T 9: 16,246,916 V1133I probably benign Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fdxacb1 TAGAC T 9: 50,772,496 probably null Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gm8374 G T 14: 7,364,174 N55K probably benign Het
Gria1 T A 11: 57,283,566 I558N probably damaging Het
Gse1 G T 8: 120,574,999 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hectd4 T C 5: 121,328,513 probably null Het
Herc1 T C 9: 66,439,181 I1943T probably benign Het
Ift172 T C 5: 31,285,238 probably benign Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Lactb T C 9: 66,971,379 probably benign Het
Map1a C T 2: 121,303,925 H1741Y probably benign Het
Map1lc3b T C 8: 121,596,720 Y110H probably benign Het
Mlh1 T C 9: 111,247,377 D304G probably damaging Het
Ncoa4 T A 14: 32,172,841 probably null Het
Neto1 T C 18: 86,398,019 probably benign Het
Nf1 T C 11: 79,535,983 V1741A possibly damaging Het
Nkain2 C A 10: 32,890,189 probably benign Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Olfr564 G A 7: 102,804,207 C243Y possibly damaging Het
Olfr615 T C 7: 103,561,119 L214P possibly damaging Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Prrxl1 C T 14: 32,608,369 P148S probably benign Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Ralgapa2 T G 2: 146,388,500 K963N probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Sag G A 1: 87,828,441 V257I probably benign Het
Scaf1 T C 7: 45,008,297 E386G probably damaging Het
Slc4a10 A G 2: 62,313,286 E1055G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Tgm2 T A 2: 158,124,252 H494L probably benign Het
Tub C T 7: 109,020,954 R102* probably null Het
Ugt3a1 T G 15: 9,306,292 L176V possibly damaging Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfp322a C T 13: 23,356,775 V266I probably benign Het
Zfp663 T C 2: 165,352,572 R576G probably damaging Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0321:Myo1f UTSW 17 33593012 missense probably benign 0.31
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R0925:Myo1f UTSW 17 33578133 missense probably damaging 0.96
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6365:Myo1f UTSW 17 33586116 missense probably benign
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7266:Myo1f UTSW 17 33601694 missense probably benign
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
R7606:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R7779:Myo1f UTSW 17 33578273 missense probably benign 0.27
R7853:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7884:Myo1f UTSW 17 33598296 missense probably damaging 1.00
R8507:Myo1f UTSW 17 33598018 missense probably benign 0.09
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer
(F):5'- cctcctgccaccccACAGTTTTAA -3'
(R):5'- CTTGACGTGCTGTCTTGTGACACT -3'

Sequencing Primer
(F):5'- cccagaacccagagagaagag -3'
(R):5'- CGAAGTTGATGCAGAACTGCTC -3'
Posted On2014-03-17