Incidental Mutation 'R1376:Taok3'
ID162878
Institutional Source Beutler Lab
Gene Symbol Taok3
Ensembl Gene ENSMUSG00000061288
Gene NameTAO kinase 3
SynonymsA430105I05Rik, 2900006A08Rik
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1376 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117120129-117275219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117265961 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 734 (Y734H)
Ref Sequence ENSEMBL: ENSMUSP00000136750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092889] [ENSMUST00000111975] [ENSMUST00000111978] [ENSMUST00000179276]
Predicted Effect probably damaging
Transcript: ENSMUST00000092889
AA Change: Y734H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090565
Gene: ENSMUSG00000061288
AA Change: Y734H

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111975
AA Change: Y274H

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107606
Gene: ENSMUSG00000061288
AA Change: Y274H

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
coiled coil region 158 189 N/A INTRINSIC
coiled coil region 329 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111978
AA Change: Y734H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107609
Gene: ENSMUSG00000061288
AA Change: Y734H

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179276
AA Change: Y734H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136750
Gene: ENSMUSG00000061288
AA Change: Y734H

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Meta Mutation Damage Score 0.2966 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 96.7%
  • 10x: 90.4%
  • 20x: 75.5%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that activates the p38/MAPK14 stress-activated MAPK cascade but inhibits the basal activity of the MAPK8/JNK cascade. The encoded protein is a member of the GCK subfamily of STE20-like kinases. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Taok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Taok3 APN 5 117272197 missense probably benign 0.20
IGL01632:Taok3 APN 5 117265928 missense possibly damaging 0.95
IGL02894:Taok3 APN 5 117263613 missense probably benign 0.19
bonze UTSW 5 117272229 nonsense probably null
daoist UTSW 5 117209571 missense probably damaging 0.99
haller UTSW 5 117206655 missense probably damaging 1.00
Perseveration UTSW 5 117255863 missense probably benign 0.25
taoist UTSW 5 117206655 missense probably damaging 1.00
Three_treasures UTSW 5 117217242 critical splice donor site probably null
PIT4366001:Taok3 UTSW 5 117227985 missense probably benign 0.21
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0158:Taok3 UTSW 5 117217242 critical splice donor site probably null
R0245:Taok3 UTSW 5 117252679 splice site probably benign
R0371:Taok3 UTSW 5 117206687 nonsense probably null
R1140:Taok3 UTSW 5 117228053 missense possibly damaging 0.94
R1302:Taok3 UTSW 5 117199043 missense possibly damaging 0.46
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1387:Taok3 UTSW 5 117206655 missense probably damaging 1.00
R1711:Taok3 UTSW 5 117255926 missense possibly damaging 0.68
R1977:Taok3 UTSW 5 117265924 missense probably damaging 0.98
R2898:Taok3 UTSW 5 117200069 critical splice acceptor site probably null
R3824:Taok3 UTSW 5 117255937 missense probably benign 0.01
R4378:Taok3 UTSW 5 117209571 missense probably damaging 0.99
R4695:Taok3 UTSW 5 117228066 missense probably benign 0.11
R4882:Taok3 UTSW 5 117252630 missense probably damaging 0.99
R5286:Taok3 UTSW 5 117266075 missense probably damaging 1.00
R5522:Taok3 UTSW 5 117273757 missense probably benign 0.00
R5562:Taok3 UTSW 5 117250964 missense probably damaging 1.00
R5643:Taok3 UTSW 5 117206720 missense probably benign
R6241:Taok3 UTSW 5 117272197 missense probably benign 0.33
R6290:Taok3 UTSW 5 117204368 missense probably damaging 1.00
R6310:Taok3 UTSW 5 117255938 missense possibly damaging 0.48
R6339:Taok3 UTSW 5 117228030 missense probably benign
R6717:Taok3 UTSW 5 117240950 intron probably benign
R6721:Taok3 UTSW 5 117255863 missense probably benign 0.25
R6755:Taok3 UTSW 5 117206667 missense probably damaging 1.00
R7046:Taok3 UTSW 5 117273706 missense probably damaging 1.00
R7053:Taok3 UTSW 5 117252562 missense probably benign 0.00
R7259:Taok3 UTSW 5 117252543 missense probably benign 0.00
R7308:Taok3 UTSW 5 117200151 nonsense probably null
R7439:Taok3 UTSW 5 117250909 missense probably damaging 0.99
R7732:Taok3 UTSW 5 117193748 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AAGCAGTTCACCCATTTGCAATCAC -3'
(R):5'- CTTACCGCTTGAGAGGCCATCATC -3'

Sequencing Primer
(F):5'- CATGAAATCCAGAGCCCTGGTAG -3'
(R):5'- GAGAGGCCATCATCTCGTTTATAC -3'
Posted On2014-03-17