Incidental Mutation 'R1376:Pdgfd'
ID162886
Institutional Source Beutler Lab
Gene Symbol Pdgfd
Ensembl Gene ENSMUSG00000032006
Gene Nameplatelet-derived growth factor, D polypeptide
Synonyms1110003I09Rik
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1376 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location6168584-6378850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6376994 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 357 (I357V)
Ref Sequence ENSEMBL: ENSMUSP00000056240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058692] [ENSMUST00000168039] [ENSMUST00000214892]
Predicted Effect probably benign
Transcript: ENSMUST00000058692
AA Change: I357V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056240
Gene: ENSMUSG00000032006
AA Change: I357V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 48 164 5.38e-25 SMART
PDGF 265 358 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168039
AA Change: I363V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128388
Gene: ENSMUSG00000032006
AA Change: I363V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 54 170 5.38e-25 SMART
PDGF 271 364 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214892
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 96.7%
  • 10x: 90.4%
  • 20x: 75.5%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. This gene product only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. Two splice variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Pdgfd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Pdgfd APN 9 6288621 nonsense probably null
IGL00806:Pdgfd APN 9 6288667 missense probably benign 0.00
IGL01481:Pdgfd APN 9 6337271 missense probably null 0.62
IGL01704:Pdgfd APN 9 6337327 missense probably damaging 1.00
IGL02951:Pdgfd APN 9 6288494 missense probably damaging 1.00
IGL03022:Pdgfd APN 9 6288495 missense probably damaging 1.00
R0122:Pdgfd UTSW 9 6293851 missense probably damaging 1.00
R0408:Pdgfd UTSW 9 6293928 nonsense probably null
R0542:Pdgfd UTSW 9 6359769 missense probably damaging 1.00
R0701:Pdgfd UTSW 9 6359706 missense probably damaging 0.98
R1376:Pdgfd UTSW 9 6376994 missense probably benign 0.00
R1563:Pdgfd UTSW 9 6293939 critical splice donor site probably null
R2513:Pdgfd UTSW 9 6359894 missense probably damaging 1.00
R3751:Pdgfd UTSW 9 6337447 splice site probably benign
R3831:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R3832:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R3833:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R4691:Pdgfd UTSW 9 6288556 missense probably damaging 1.00
R6280:Pdgfd UTSW 9 6288627 missense probably benign 0.00
R6622:Pdgfd UTSW 9 6293818 missense probably damaging 1.00
R7488:Pdgfd UTSW 9 6359739 missense probably damaging 1.00
R7581:Pdgfd UTSW 9 6293894 missense probably damaging 1.00
R7873:Pdgfd UTSW 9 6337271 missense probably benign 0.06
R7883:Pdgfd UTSW 9 6293939 critical splice donor site probably null
R7956:Pdgfd UTSW 9 6337271 missense probably benign 0.06
R7966:Pdgfd UTSW 9 6293939 critical splice donor site probably null
RF009:Pdgfd UTSW 9 6288624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCATGTTGCATGGTTAGCG -3'
(R):5'- TGGACAAGTGCCTTCTTTAAGTGAGC -3'

Sequencing Primer
(F):5'- TTACTCACTCATTACCAGAAGGGG -3'
(R):5'- GTGCCTTCTTTAAGTGAGCAAAATC -3'
Posted On2014-03-17