Incidental Mutation 'R1377:Zfp804a'
Institutional Source Beutler Lab
Gene Symbol Zfp804a
Ensembl Gene ENSMUSG00000070866
Gene Namezinc finger protein 804A
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosomal Location82053222-82259879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82258497 bp
Amino Acid Change Valine to Alanine at position 890 (V890A)
Ref Sequence ENSEMBL: ENSMUSP00000041941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047527]
Predicted Effect probably benign
Transcript: ENSMUST00000047527
AA Change: V890A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: V890A

ZnF_C2H2 57 81 7.29e0 SMART
low complexity region 588 595 N/A INTRINSIC
low complexity region 801 808 N/A INTRINSIC
low complexity region 1012 1029 N/A INTRINSIC
low complexity region 1061 1077 N/A INTRINSIC
low complexity region 1168 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127187
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Zfp804a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Zfp804a APN 2 82053875 missense probably benign 0.30
IGL02011:Zfp804a APN 2 82256691 missense probably damaging 1.00
IGL02218:Zfp804a APN 2 82259202 missense probably damaging 1.00
IGL02645:Zfp804a APN 2 82053876 missense possibly damaging 0.94
PIT4431001:Zfp804a UTSW 2 82259192 missense probably benign 0.04
R0027:Zfp804a UTSW 2 82257200 missense probably damaging 1.00
R0167:Zfp804a UTSW 2 82256516 missense probably damaging 1.00
R0437:Zfp804a UTSW 2 82053791 start codon destroyed probably null 0.08
R0521:Zfp804a UTSW 2 82259417 nonsense probably null
R0546:Zfp804a UTSW 2 82258920 missense possibly damaging 0.91
R0609:Zfp804a UTSW 2 82257588 missense probably damaging 1.00
R0694:Zfp804a UTSW 2 82053804 missense probably damaging 1.00
R0837:Zfp804a UTSW 2 82259162 missense probably damaging 1.00
R0947:Zfp804a UTSW 2 82258718 missense possibly damaging 0.58
R1103:Zfp804a UTSW 2 82257500 missense probably damaging 0.99
R1168:Zfp804a UTSW 2 82256697 missense probably benign 0.43
R1365:Zfp804a UTSW 2 82257246 missense probably benign 0.00
R1501:Zfp804a UTSW 2 82235799 missense probably damaging 1.00
R1526:Zfp804a UTSW 2 82258188 missense probably benign
R1585:Zfp804a UTSW 2 82053751 start gained probably benign
R1674:Zfp804a UTSW 2 82258824 missense probably benign 0.35
R2058:Zfp804a UTSW 2 82257366 missense probably benign 0.00
R2146:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2149:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2171:Zfp804a UTSW 2 82257183 missense possibly damaging 0.77
R2307:Zfp804a UTSW 2 82256857 missense probably benign 0.04
R2398:Zfp804a UTSW 2 82258669 missense possibly damaging 0.95
R2496:Zfp804a UTSW 2 82235844 missense probably damaging 1.00
R2504:Zfp804a UTSW 2 82257519 missense probably benign 0.00
R2919:Zfp804a UTSW 2 82235816 missense probably damaging 1.00
R2943:Zfp804a UTSW 2 82235879 missense probably damaging 1.00
R3116:Zfp804a UTSW 2 82259417 missense probably damaging 1.00
R4170:Zfp804a UTSW 2 82253488 missense probably damaging 1.00
R4393:Zfp804a UTSW 2 82256921 missense probably benign 0.43
R4701:Zfp804a UTSW 2 82256582 missense probably damaging 1.00
R4771:Zfp804a UTSW 2 82257942 missense probably benign 0.01
R4793:Zfp804a UTSW 2 82235842 missense probably damaging 1.00
R5523:Zfp804a UTSW 2 82258995 missense probably damaging 1.00
R5526:Zfp804a UTSW 2 82258590 missense probably benign 0.00
R5961:Zfp804a UTSW 2 82258002 missense probably benign
R6181:Zfp804a UTSW 2 82257142 missense probably damaging 1.00
R6209:Zfp804a UTSW 2 82258118 missense probably damaging 1.00
R6325:Zfp804a UTSW 2 82257038 missense possibly damaging 0.80
R7147:Zfp804a UTSW 2 82258187 missense probably benign 0.00
R7229:Zfp804a UTSW 2 82258625 missense probably benign 0.04
R7666:Zfp804a UTSW 2 82259060 nonsense probably null
R7910:Zfp804a UTSW 2 82256573 missense probably damaging 1.00
R8256:Zfp804a UTSW 2 82053849 missense probably damaging 0.99
X0064:Zfp804a UTSW 2 82235823 missense probably damaging 1.00
Z1177:Zfp804a UTSW 2 82258563 missense probably benign 0.25
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-03-17