Mutagenetix > Incidental Mutations

Incidental Mutation 'R1377:Zfp804a'

162900

Institutional Source

Beutler Lab

Gene Symbol

Zfp804a

Ensembl Gene

ENSMUSG00000070866

Gene Name

zinc finger protein 804A

Synonyms

MMRRC Submission

039441-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R1377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82053222-82259879 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82258497 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 890 (V890A)

Ref Sequence

ENSEMBL: ENSMUSP00000041941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047527]

Predicted Effect

probably benign
Transcript: ENSMUST00000047527
AA Change: V890A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: V890A

Domain	Start	End	E-Value	Type
ZnF_C2H2	57	81	7.29e0	SMART
low complexity region	588	595	N/A	INTRINSIC
low complexity region	801	808	N/A	INTRINSIC
low complexity region	1012	1029	N/A	INTRINSIC
low complexity region	1061	1077	N/A	INTRINSIC
low complexity region	1168	1191	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127187

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	A	G	16: 31,116,051	V363A	probably damaging	Het
Arc	G	A	15: 74,672,252	H41Y	possibly damaging	Het
Atp7b	G	A	8: 22,011,785	A854V	probably benign	Het
Ccng1	G	A	11: 40,752,114	P169S	probably benign	Het
Dnah8	A	T	17: 30,840,622	K4399*	probably null	Het
Dscam	A	G	16: 96,772,494	V756A	probably damaging	Het
Exoc3l4	A	T	12: 111,428,670	E574V	probably damaging	Het
Fbxo46	T	A	7: 19,136,425	V323E	probably damaging	Het
Gria1	C	A	11: 57,201,176	N163K	probably damaging	Het
Has2	T	C	15: 56,681,806	I133M	probably damaging	Het
Itgal	T	A	7: 127,321,917	L750Q	probably damaging	Het
Ptprk	G	A	10: 28,586,026	R1195Q	probably benign	Het
Rbm15	T	C	3: 107,330,758	T775A	probably benign	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Sipa1l2	T	C	8: 125,491,977	E207G	probably damaging	Het
Slc38a6	T	A	12: 73,350,571	I329N	probably damaging	Het
Stoml3	G	A	3: 53,507,641	A285T	probably benign	Het
Trhr2	C	T	8: 122,360,588	V38M	probably damaging	Het
Trp53bp1	A	G	2: 121,270,642	L25P	probably damaging	Het
Wdr33	T	A	18: 31,888,641	M748K	unknown	Het
Zfp454	T	C	11: 50,873,780	Y164C	probably damaging	Het
Zxdc	T	C	6: 90,378,903	S465P	probably damaging	Het

Other mutations in Zfp804a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Zfp804a	APN	2	82053875	missense	probably benign	0.30
IGL02011:Zfp804a	APN	2	82256691	missense	probably damaging	1.00
IGL02218:Zfp804a	APN	2	82259202	missense	probably damaging	1.00
IGL02645:Zfp804a	APN	2	82053876	missense	possibly damaging	0.94
PIT4431001:Zfp804a	UTSW	2	82259192	missense	probably benign	0.04
R0027:Zfp804a	UTSW	2	82257200	missense	probably damaging	1.00
R0167:Zfp804a	UTSW	2	82256516	missense	probably damaging	1.00
R0437:Zfp804a	UTSW	2	82053791	start codon destroyed	probably null	0.08
R0521:Zfp804a	UTSW	2	82259417	nonsense	probably null
R0546:Zfp804a	UTSW	2	82258920	missense	possibly damaging	0.91
R0609:Zfp804a	UTSW	2	82257588	missense	probably damaging	1.00
R0694:Zfp804a	UTSW	2	82053804	missense	probably damaging	1.00
R0837:Zfp804a	UTSW	2	82259162	missense	probably damaging	1.00
R0947:Zfp804a	UTSW	2	82258718	missense	possibly damaging	0.58
R1103:Zfp804a	UTSW	2	82257500	missense	probably damaging	0.99
R1168:Zfp804a	UTSW	2	82256697	missense	probably benign	0.43
R1365:Zfp804a	UTSW	2	82257246	missense	probably benign	0.00
R1501:Zfp804a	UTSW	2	82235799	missense	probably damaging	1.00
R1526:Zfp804a	UTSW	2	82258188	missense	probably benign
R1585:Zfp804a	UTSW	2	82053751	start gained	probably benign
R1674:Zfp804a	UTSW	2	82258824	missense	probably benign	0.35
R2058:Zfp804a	UTSW	2	82257366	missense	probably benign	0.00
R2146:Zfp804a	UTSW	2	82258664	missense	probably benign	0.02
R2149:Zfp804a	UTSW	2	82258664	missense	probably benign	0.02
R2171:Zfp804a	UTSW	2	82257183	missense	possibly damaging	0.77
R2307:Zfp804a	UTSW	2	82256857	missense	probably benign	0.04
R2398:Zfp804a	UTSW	2	82258669	missense	possibly damaging	0.95
R2496:Zfp804a	UTSW	2	82235844	missense	probably damaging	1.00
R2504:Zfp804a	UTSW	2	82257519	missense	probably benign	0.00
R2919:Zfp804a	UTSW	2	82235816	missense	probably damaging	1.00
R2943:Zfp804a	UTSW	2	82235879	missense	probably damaging	1.00
R3116:Zfp804a	UTSW	2	82259417	missense	probably damaging	1.00
R4170:Zfp804a	UTSW	2	82253488	missense	probably damaging	1.00
R4393:Zfp804a	UTSW	2	82256921	missense	probably benign	0.43
R4701:Zfp804a	UTSW	2	82256582	missense	probably damaging	1.00
R4771:Zfp804a	UTSW	2	82257942	missense	probably benign	0.01
R4793:Zfp804a	UTSW	2	82235842	missense	probably damaging	1.00
R5523:Zfp804a	UTSW	2	82258995	missense	probably damaging	1.00
R5526:Zfp804a	UTSW	2	82258590	missense	probably benign	0.00
R5961:Zfp804a	UTSW	2	82258002	missense	probably benign
R6181:Zfp804a	UTSW	2	82257142	missense	probably damaging	1.00
R6209:Zfp804a	UTSW	2	82258118	missense	probably damaging	1.00
R6325:Zfp804a	UTSW	2	82257038	missense	possibly damaging	0.80
R7147:Zfp804a	UTSW	2	82258187	missense	probably benign	0.00
R7229:Zfp804a	UTSW	2	82258625	missense	probably benign	0.04
R7666:Zfp804a	UTSW	2	82259060	nonsense	probably null
R7910:Zfp804a	UTSW	2	82256573	missense	probably damaging	1.00
R8256:Zfp804a	UTSW	2	82053849	missense	probably damaging	0.99
X0064:Zfp804a	UTSW	2	82235823	missense	probably damaging	1.00
Z1177:Zfp804a	UTSW	2	82258563	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CCGACTCCACATTGGAGATGGAAC -3'
(R):5'- GAATGGTCTCGGCCAGCTCATATC -3'

Sequencing Primer
(F):5'- GAAGTGTAGTTCTTTGAGTCAACCAG -3'
(R):5'- GCAAATGTACGACTTTGCCTG -3'

Posted On

2014-03-17