Incidental Mutation 'R1377:Stoml3'
ID162903
Institutional Source Beutler Lab
Gene Symbol Stoml3
Ensembl Gene ENSMUSG00000027744
Gene Namestomatin (Epb7.2)-like 3
SynonymsSRO, SLP3
MMRRC Submission 039441-MU
Accession Numbers

Genbank: NM_153156; MGI: 2388072

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location53488653-53508502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53507641 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 285 (A285T)
Ref Sequence ENSEMBL: ENSMUSP00000029307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029307]
Predicted Effect probably benign
Transcript: ENSMUST00000029307
AA Change: A285T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029307
Gene: ENSMUSG00000027744
AA Change: A285T

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
PHB 45 204 3.56e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198286
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display loss of mechanoreceptor function and impaired tactile-driven behaviors. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Stoml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Stoml3 APN 3 53498127 missense probably benign 0.00
IGL02394:Stoml3 APN 3 53498119 splice site probably benign
IGL02406:Stoml3 APN 3 53503250 missense probably damaging 1.00
3-1:Stoml3 UTSW 3 53497975 missense probably benign 0.00
D3080:Stoml3 UTSW 3 53497994 missense probably benign 0.29
R0755:Stoml3 UTSW 3 53498138 nonsense probably null
R1702:Stoml3 UTSW 3 53505431 missense probably benign 0.00
R1945:Stoml3 UTSW 3 53505445 missense possibly damaging 0.86
R2155:Stoml3 UTSW 3 53507587 missense probably damaging 1.00
R3890:Stoml3 UTSW 3 53507454 missense probably damaging 1.00
R5048:Stoml3 UTSW 3 53500792 missense possibly damaging 0.64
R5717:Stoml3 UTSW 3 53505516 missense probably damaging 1.00
R6275:Stoml3 UTSW 3 53507506 missense probably damaging 0.98
R6291:Stoml3 UTSW 3 53507516 missense probably damaging 1.00
R7686:Stoml3 UTSW 3 53503168 missense probably damaging 1.00
Z1176:Stoml3 UTSW 3 53503226 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTCTTTGCCAAGAACGTGAGC -3'
(R):5'- TTATCAGTCACCTAGAGTCTCCGCC -3'

Sequencing Primer
(F):5'- GCTTCAAAGTCTCTGAAGTCAGC -3'
(R):5'- TCAAAGCAGTGCATGGCTC -3'
Posted On2014-03-17