Incidental Mutation 'R1377:Rbm15'
ID162904
Institutional Source Beutler Lab
Gene Symbol Rbm15
Ensembl Gene ENSMUSG00000048109
Gene NameRNA binding motif protein 15
Synonyms
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107325421-107333673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107330758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 775 (T775A)
Ref Sequence ENSEMBL: ENSMUSP00000054424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061772]
Predicted Effect probably benign
Transcript: ENSMUST00000061772
AA Change: T775A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054424
Gene: ENSMUSG00000048109
AA Change: T775A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 56 96 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 133 163 N/A INTRINSIC
RRM 170 247 7.49e-5 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
RRM 374 446 1.33e-10 SMART
RRM 455 524 2.51e-6 SMART
low complexity region 532 542 N/A INTRINSIC
low complexity region 564 582 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
internal_repeat_2 613 685 7.13e-5 PROSPERO
internal_repeat_2 677 753 7.13e-5 PROSPERO
low complexity region 754 771 N/A INTRINSIC
Pfam:SPOC 789 925 1.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197769
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality around E9.5. Mice homozygous for a floxed allele activate in hematopoietic cells exhibit increased megakaryocyte cell number, long-term hematopoietic stem cells, and red pulp as well as decreased B cells and leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Rbm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rbm15 APN 3 107331010 missense probably damaging 0.98
IGL01933:Rbm15 APN 3 107331103 missense probably damaging 0.99
IGL02116:Rbm15 APN 3 107330280 missense probably damaging 1.00
IGL02886:Rbm15 APN 3 107326295 missense probably benign 0.41
R0281:Rbm15 UTSW 3 107331155 missense probably damaging 0.99
R0374:Rbm15 UTSW 3 107330564 missense probably damaging 1.00
R0376:Rbm15 UTSW 3 107330938 missense probably benign 0.00
R0501:Rbm15 UTSW 3 107332530 missense possibly damaging 0.91
R0517:Rbm15 UTSW 3 107331369 missense probably damaging 1.00
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1348:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1372:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1373:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1616:Rbm15 UTSW 3 107330881 missense probably benign
R1708:Rbm15 UTSW 3 107331220 missense probably damaging 1.00
R1944:Rbm15 UTSW 3 107331552 missense probably damaging 1.00
R2519:Rbm15 UTSW 3 107330833 missense probably benign 0.08
R3432:Rbm15 UTSW 3 107330677 missense probably benign 0.32
R4885:Rbm15 UTSW 3 107332254 missense probably benign 0.25
R5434:Rbm15 UTSW 3 107330467 missense possibly damaging 0.70
R6915:Rbm15 UTSW 3 107332311 missense probably benign 0.07
R7336:Rbm15 UTSW 3 107333116 start gained probably benign
R7799:Rbm15 UTSW 3 107332143 missense probably damaging 0.98
R8115:Rbm15 UTSW 3 107331650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGAGCCCTCCACAAGTAGACTG -3'
(R):5'- AACAGCGTCACTGCACTCCTTC -3'

Sequencing Primer
(F):5'- CTGCCAAGCCAAACAGAGTT -3'
(R):5'- AGGTCTTCCCCAGTCAGAGATAG -3'
Posted On2014-03-17