Incidental Mutation 'R1377:Zxdc'
List |< first << previous [record 23 of 23]
ID162906
Institutional Source Beutler Lab
Gene Symbol Zxdc
Ensembl Gene ENSMUSG00000034430
Gene NameZXD family zinc finger C
SynonymsB930086F11Rik
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1377 (G1)
Quality Score181
Status Not validated
Chromosome6
Chromosomal Location90369492-90403490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90378903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 465 (S465P)
Ref Sequence ENSEMBL: ENSMUSP00000109167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045740] [ENSMUST00000075117] [ENSMUST00000113539]
Predicted Effect probably damaging
Transcript: ENSMUST00000045740
AA Change: S465P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036329
Gene: ENSMUSG00000034430
AA Change: S465P

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075117
AA Change: S465P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430
AA Change: S465P

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113539
AA Change: S465P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109167
Gene: ENSMUSG00000034430
AA Change: S465P

DomainStartEndE-ValueType
low complexity region 44 95 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
ZnF_C2H2 198 222 4.79e-3 SMART
ZnF_C2H2 231 255 4.3e-5 SMART
ZnF_C2H2 261 285 4.3e-5 SMART
ZnF_C2H2 291 313 1.69e-3 SMART
ZnF_C2H2 320 344 1.82e-3 SMART
ZnF_C2H2 351 375 1.26e-2 SMART
ZnF_C2H2 381 405 1.36e-2 SMART
ZnF_C2H2 411 435 5.21e-4 SMART
ZnF_C2H2 441 465 4.72e-2 SMART
ZnF_C2H2 474 499 3.07e-1 SMART
low complexity region 509 524 N/A INTRINSIC
low complexity region 657 673 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137483
Predicted Effect probably benign
Transcript: ENSMUST00000203493
Meta Mutation Damage Score 0.2509 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Other mutations in Zxdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Zxdc APN 6 90373779 missense probably damaging 1.00
IGL01943:Zxdc APN 6 90372538 intron probably benign
IGL02406:Zxdc APN 6 90398836 missense probably benign 0.00
IGL02596:Zxdc APN 6 90373709 critical splice acceptor site probably null
IGL02623:Zxdc APN 6 90382370 missense probably damaging 0.99
IGL02927:Zxdc APN 6 90372562 missense probably damaging 1.00
IGL03230:Zxdc APN 6 90373803 missense probably damaging 1.00
PIT4378001:Zxdc UTSW 6 90373716 missense probably damaging 1.00
R0071:Zxdc UTSW 6 90370416 missense probably damaging 1.00
R0194:Zxdc UTSW 6 90372537 intron probably benign
R1065:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1692:Zxdc UTSW 6 90378951 nonsense probably null
R2171:Zxdc UTSW 6 90382479 missense possibly damaging 0.53
R3952:Zxdc UTSW 6 90370467 intron probably null
R4400:Zxdc UTSW 6 90369810 missense probably damaging 1.00
R4660:Zxdc UTSW 6 90378838 missense probably damaging 0.99
R4776:Zxdc UTSW 6 90370518 missense probably damaging 1.00
R4781:Zxdc UTSW 6 90372553 missense probably damaging 0.98
R4843:Zxdc UTSW 6 90382272 missense possibly damaging 0.94
R5028:Zxdc UTSW 6 90382338 missense probably benign 0.44
R5260:Zxdc UTSW 6 90382093 missense probably damaging 1.00
R5279:Zxdc UTSW 6 90370437 missense possibly damaging 0.86
R5324:Zxdc UTSW 6 90373800 missense probably damaging 1.00
R5363:Zxdc UTSW 6 90382146 missense probably damaging 0.97
R5436:Zxdc UTSW 6 90370560 missense probably damaging 0.99
R5872:Zxdc UTSW 6 90370299 missense probably damaging 0.99
R5940:Zxdc UTSW 6 90370325 missense probably damaging 1.00
R6762:Zxdc UTSW 6 90382183 missense probably benign
R7175:Zxdc UTSW 6 90369663 missense possibly damaging 0.85
R7197:Zxdc UTSW 6 90378837 missense probably damaging 0.99
R7238:Zxdc UTSW 6 90369660 missense unknown
R7247:Zxdc UTSW 6 90384173 missense unknown
Predicted Primers PCR Primer
(F):5'- ctgaattgtcttatcagtccAGTGTCATTTCT -3'
(R):5'- CTTCTCTCATACCCCAGCCCATTCC -3'

Sequencing Primer
(F):5'- tcagtccAGTGTCATTTCTGATGTAG -3'
(R):5'- GTCCATCTGTAGGACACAGTC -3'
Posted On2014-03-17