Incidental Mutation 'R1377:Fbxo46'
List |< first << previous [record 8 of 23] next >> last >|
ID162907
Institutional Source Beutler Lab
Gene Symbol Fbxo46
Ensembl Gene ENSMUSG00000050428
Gene NameF-box protein 46
Synonyms4932704E22Rik, 20D7-FC4, Fbxo34l
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19119859-19140172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19136425 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 323 (V323E)
Ref Sequence ENSEMBL: ENSMUSP00000129427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032566] [ENSMUST00000053109] [ENSMUST00000165913]
Predicted Effect probably benign
Transcript: ENSMUST00000032566
SMART Domains Protein: ENSMUSP00000032566
Gene: ENSMUSG00000030407

DomainStartEndE-ValueType
low complexity region 27 48 N/A INTRINSIC
Pfam:Peptidase_M28 151 377 2.3e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053109
AA Change: V323E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055692
Gene: ENSMUSG00000050428
AA Change: V323E

DomainStartEndE-ValueType
low complexity region 274 292 N/A INTRINSIC
low complexity region 337 358 N/A INTRINSIC
low complexity region 366 375 N/A INTRINSIC
low complexity region 415 424 N/A INTRINSIC
FBOX 476 516 1.9e-5 SMART
low complexity region 591 603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165913
AA Change: V323E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129427
Gene: ENSMUSG00000050428
AA Change: V323E

DomainStartEndE-ValueType
low complexity region 274 292 N/A INTRINSIC
low complexity region 337 358 N/A INTRINSIC
low complexity region 366 375 N/A INTRINSIC
low complexity region 415 424 N/A INTRINSIC
FBOX 476 516 1.9e-5 SMART
low complexity region 591 603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO46, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Fbxo46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Fbxo46 APN 7 19136803 missense probably damaging 1.00
IGL01655:Fbxo46 APN 7 19136310 missense probably damaging 1.00
IGL02869:Fbxo46 APN 7 19137214 missense probably damaging 0.99
IGL02940:Fbxo46 APN 7 19135612 missense probably benign 0.00
R0517:Fbxo46 UTSW 7 19136874 missense possibly damaging 0.78
R0840:Fbxo46 UTSW 7 19137148 missense possibly damaging 0.90
R0894:Fbxo46 UTSW 7 19135729 missense probably damaging 0.98
R2303:Fbxo46 UTSW 7 19136616 missense possibly damaging 0.69
R4601:Fbxo46 UTSW 7 19135564 missense probably benign
R5394:Fbxo46 UTSW 7 19136616 missense possibly damaging 0.69
R5530:Fbxo46 UTSW 7 19136802 missense probably damaging 1.00
R5743:Fbxo46 UTSW 7 19136495 missense probably damaging 1.00
R6320:Fbxo46 UTSW 7 19136541 missense possibly damaging 0.83
R7639:Fbxo46 UTSW 7 19136635 missense probably damaging 1.00
R7748:Fbxo46 UTSW 7 19136533 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTTTCCGAATCTCCAATGTCCG -3'
(R):5'- AGGCACACAGTCTCTTCCTTCACG -3'

Sequencing Primer
(F):5'- GAATCTCCAATGTCCGAGAGC -3'
(R):5'- GTGCCATCTTTGCCAAAGAAG -3'
Posted On2014-03-17