Incidental Mutation 'R1377:Trhr2'
List |< first << previous [record 18 of 23] next >> last >|
ID162910
Institutional Source Beutler Lab
Gene Symbol Trhr2
Ensembl Gene ENSMUSG00000039079
Gene Namethyrotropin releasing hormone receptor 2
SynonymsTRH-R2
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122356967-122360746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122360588 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 38 (V38M)
Ref Sequence ENSEMBL: ENSMUSP00000042575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044123] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000044123
AA Change: V38M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042575
Gene: ENSMUSG00000039079
AA Change: V38M

DomainStartEndE-ValueType
Pfam:7tm_4 29 184 1e-12 PFAM
Pfam:7TM_GPCR_Srv 29 325 2e-7 PFAM
Pfam:7TM_GPCR_Srx 30 165 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 33 323 5.6e-10 PFAM
Pfam:7tm_1 39 308 5.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Trhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:Trhr2 APN 8 122358603 missense probably benign
IGL03387:Trhr2 APN 8 122358481 intron probably benign
IGL03408:Trhr2 APN 8 122358795 missense probably damaging 1.00
R0546:Trhr2 UTSW 8 122358489 critical splice donor site probably null
R1135:Trhr2 UTSW 8 122358633 missense probably damaging 1.00
R1656:Trhr2 UTSW 8 122357446 missense probably damaging 1.00
R2055:Trhr2 UTSW 8 122358793 missense probably damaging 1.00
R4030:Trhr2 UTSW 8 122360699 start codon destroyed probably null 0.01
R4998:Trhr2 UTSW 8 122358772 missense probably benign 0.04
R5074:Trhr2 UTSW 8 122357371 missense probably benign 0.01
R6175:Trhr2 UTSW 8 122357379 missense probably damaging 0.99
R7048:Trhr2 UTSW 8 122358679 missense probably damaging 1.00
R7168:Trhr2 UTSW 8 122360537 missense probably damaging 1.00
R7185:Trhr2 UTSW 8 122360657 missense probably benign 0.26
R7284:Trhr2 UTSW 8 122360375 missense probably damaging 1.00
R7314:Trhr2 UTSW 8 122358750 missense possibly damaging 0.64
R7644:Trhr2 UTSW 8 122357322 missense possibly damaging 0.93
R7891:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
R7974:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
Z1176:Trhr2 UTSW 8 122358795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCCTGCTTGAATCCAGGCTC -3'
(R):5'- CACAGGTCACTTACCAAGGTCAAGG -3'

Sequencing Primer
(F):5'- TACTGGAAGTAGGTGATGCCC -3'
(R):5'- GCAATGTCTCACTCGTTCAC -3'
Posted On2014-03-17