Incidental Mutation 'R1377:Rbpms2'
ID162912
Institutional Source Beutler Lab
Gene Symbol Rbpms2
Ensembl Gene ENSMUSG00000032387
Gene NameRNA binding protein with multiple splicing 2
Synonyms2400008B06Rik
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1377 (G1)
Quality Score217
Status Not validated
Chromosome9
Chromosomal Location65629648-65660528 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC at 65651666 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055844] [ENSMUST00000169003] [ENSMUST00000216342] [ENSMUST00000216382]
Predicted Effect probably benign
Transcript: ENSMUST00000055844
SMART Domains Protein: ENSMUSP00000057600
Gene: ENSMUSG00000032387

DomainStartEndE-ValueType
RRM 26 98 7.84e-8 SMART
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169003
SMART Domains Protein: ENSMUSP00000131076
Gene: ENSMUSG00000032387

DomainStartEndE-ValueType
RRM 26 98 7.84e-8 SMART
low complexity region 135 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213927
Predicted Effect probably benign
Transcript: ENSMUST00000216342
Predicted Effect probably benign
Transcript: ENSMUST00000216382
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RNA recognition motif (RRM)-containing protein family and is involved in the development and dedifferentiation of digestive smooth muscle cells. The encoded protein functions as a homodimer and indirectly inhibits the bone morphogenetic protein pathway. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Rbpms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0567:Rbpms2 UTSW 9 65651666 unclassified probably benign
R0568:Rbpms2 UTSW 9 65651666 unclassified probably benign
R0570:Rbpms2 UTSW 9 65659194 nonsense probably null
R0727:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1374:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1375:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1390:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1412:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1662:Rbpms2 UTSW 9 65651042 missense probably benign 0.05
R1710:Rbpms2 UTSW 9 65659212 splice site probably benign
R1714:Rbpms2 UTSW 9 65651665 unclassified probably benign
R1714:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1715:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651680 unclassified probably benign
R1839:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1882:Rbpms2 UTSW 9 65651666 unclassified probably benign
R2088:Rbpms2 UTSW 9 65630839 missense probably damaging 0.99
R2118:Rbpms2 UTSW 9 65650947 missense probably damaging 1.00
R2237:Rbpms2 UTSW 9 65651611 nonsense probably null
R4633:Rbpms2 UTSW 9 65651636 missense probably benign 0.02
R7249:Rbpms2 UTSW 9 65649350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATTCATCAAGCCAAGCAAGTTCACG -3'
(R):5'- TGAGAAAAGACAACAATTCTGTTGCTGC -3'

Sequencing Primer
(F):5'- CCTGGTCTTGAGGAAGGGTAAC -3'
(R):5'- CACTCAAAATGGCTTACCTGAGC -3'
Posted On2014-03-17