Incidental Mutation 'R1377:Ccng1'
ID162916
Institutional Source Beutler Lab
Gene Symbol Ccng1
Ensembl Gene ENSMUSG00000020326
Gene Namecyclin G1
Synonymscyclin G
MMRRC Submission 039441-MU
Accession Numbers

Genbank: NM_009831

Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location40748552-40755311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40752114 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 169 (P169S)
Ref Sequence ENSEMBL: ENSMUSP00000020576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020576]
Predicted Effect probably benign
Transcript: ENSMUST00000020576
AA Change: P169S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020576
Gene: ENSMUSG00000020326
AA Change: P169S

DomainStartEndE-ValueType
CYCLIN 56 142 3.63e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151359
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Depending on the allele, homozygous mutants exhibit increased cellular sensitivity to gamma-irradiation or decreased incidence of induced hepatic tumors. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Ccng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ccng1 APN 11 40754058 missense probably benign 0.00
IGL01875:Ccng1 APN 11 40752356 missense probably benign 0.09
IGL02986:Ccng1 APN 11 40750863 utr 3 prime probably benign
G5030:Ccng1 UTSW 11 40753802 splice site probably benign
R1375:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R1715:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R3620:Ccng1 UTSW 11 40752165 missense probably benign 0.01
R3857:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R3858:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R5082:Ccng1 UTSW 11 40752188 missense possibly damaging 0.77
R5172:Ccng1 UTSW 11 40751286 missense probably benign
R5521:Ccng1 UTSW 11 40752266 missense possibly damaging 0.87
R7431:Ccng1 UTSW 11 40753918 missense possibly damaging 0.74
R8009:Ccng1 UTSW 11 40751269 missense probably benign 0.00
T0975:Ccng1 UTSW 11 40754044 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGGCAGGCATCTTTTCACTTC -3'
(R):5'- ACCCAAAGCCACTGGTTTCAAGTAG -3'

Sequencing Primer
(F):5'- CACTTCTGTTAGGCAGCAAAG -3'
(R):5'- GTGTCCTACTGAAGCACTGTAAAG -3'
Posted On2014-03-17