Incidental Mutation 'R1377:Zfp454'
List |< first << previous [record 21 of 23] next >> last >|
ID162917
Institutional Source Beutler Lab
Gene Symbol Zfp454
Ensembl Gene ENSMUSG00000048728
Gene Namezinc finger protein 454
Synonyms
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50872720-50887651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50873780 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 164 (Y164C)
Ref Sequence ENSEMBL: ENSMUSP00000104759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050595] [ENSMUST00000109131] [ENSMUST00000125749] [ENSMUST00000163301]
Predicted Effect probably damaging
Transcript: ENSMUST00000050595
AA Change: Y275C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061824
Gene: ENSMUSG00000048728
AA Change: Y275C

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
ZnF_C2H2 191 213 9.73e-4 SMART
ZnF_C2H2 230 252 6.32e-3 SMART
ZnF_C2H2 258 280 2.4e-3 SMART
ZnF_C2H2 286 308 8.22e-2 SMART
ZnF_C2H2 314 336 1.33e-1 SMART
ZnF_C2H2 342 364 1.84e-4 SMART
ZnF_C2H2 370 392 9.73e-4 SMART
ZnF_C2H2 398 420 5.21e-4 SMART
ZnF_C2H2 426 448 4.87e-4 SMART
ZnF_C2H2 454 476 2.12e-4 SMART
ZnF_C2H2 482 504 1.04e-3 SMART
ZnF_C2H2 510 532 2.95e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109131
AA Change: Y164C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104759
Gene: ENSMUSG00000048728
AA Change: Y164C

DomainStartEndE-ValueType
ZnF_C2H2 80 102 9.73e-4 SMART
ZnF_C2H2 119 141 6.32e-3 SMART
ZnF_C2H2 147 169 2.4e-3 SMART
ZnF_C2H2 175 197 8.22e-2 SMART
ZnF_C2H2 203 225 1.33e-1 SMART
ZnF_C2H2 231 253 1.84e-4 SMART
ZnF_C2H2 259 281 9.73e-4 SMART
ZnF_C2H2 287 309 5.21e-4 SMART
ZnF_C2H2 315 337 4.87e-4 SMART
ZnF_C2H2 343 365 2.12e-4 SMART
ZnF_C2H2 371 393 1.04e-3 SMART
ZnF_C2H2 399 421 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125749
SMART Domains Protein: ENSMUSP00000122658
Gene: ENSMUSG00000048728

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136599
Predicted Effect probably damaging
Transcript: ENSMUST00000163301
AA Change: Y275C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129125
Gene: ENSMUSG00000048728
AA Change: Y275C

DomainStartEndE-ValueType
KRAB 14 75 1.35e-29 SMART
ZnF_C2H2 191 213 9.73e-4 SMART
ZnF_C2H2 230 252 6.32e-3 SMART
ZnF_C2H2 258 280 2.4e-3 SMART
ZnF_C2H2 286 308 8.22e-2 SMART
ZnF_C2H2 314 336 1.33e-1 SMART
ZnF_C2H2 342 364 1.84e-4 SMART
ZnF_C2H2 370 392 9.73e-4 SMART
ZnF_C2H2 398 420 5.21e-4 SMART
ZnF_C2H2 426 448 4.87e-4 SMART
ZnF_C2H2 454 476 2.12e-4 SMART
ZnF_C2H2 482 504 1.04e-3 SMART
ZnF_C2H2 510 532 2.95e-3 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Zfp454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Zfp454 APN 11 50874206 missense probably benign 0.22
IGL01631:Zfp454 APN 11 50883735 missense probably benign
R0109:Zfp454 UTSW 11 50883775 missense possibly damaging 0.71
R0606:Zfp454 UTSW 11 50874185 missense probably benign 0.00
R0743:Zfp454 UTSW 11 50873937 missense probably benign 0.01
R0884:Zfp454 UTSW 11 50873937 missense probably benign 0.01
R1181:Zfp454 UTSW 11 50873586 missense probably damaging 1.00
R2126:Zfp454 UTSW 11 50873995 missense probably benign 0.44
R4869:Zfp454 UTSW 11 50873153 missense probably damaging 1.00
R4973:Zfp454 UTSW 11 50874123 missense probably benign
R5379:Zfp454 UTSW 11 50883802 missense probably damaging 0.99
R5997:Zfp454 UTSW 11 50873622 missense probably damaging 1.00
R6321:Zfp454 UTSW 11 50873049 missense probably damaging 0.98
R6490:Zfp454 UTSW 11 50874123 missense probably benign
R6892:Zfp454 UTSW 11 50873198 missense probably damaging 1.00
R7362:Zfp454 UTSW 11 50886367 critical splice donor site probably null
R7650:Zfp454 UTSW 11 50883753 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCGAGGTTTGCAGTCTGGTTGAA -3'
(R):5'- TCTCTAAGAGTTCCACCCTTAAGAAGCA -3'

Sequencing Primer
(F):5'- ccctgaaagccttctcacac -3'
(R):5'- GAAGCATCAGAAACTTCATACCG -3'
Posted On2014-03-17