Incidental Mutation 'R1377:Gria1'
ID162918
Institutional Source Beutler Lab
Gene Symbol Gria1
Ensembl Gene ENSMUSG00000020524
Gene Nameglutamate receptor, ionotropic, AMPA1 (alpha 1)
SynonymsGlr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location57011387-57330244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57201176 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 163 (N163K)
Ref Sequence ENSEMBL: ENSMUSP00000117746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]
Predicted Effect probably damaging
Transcript: ENSMUST00000036315
AA Change: N232K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524
AA Change: N232K

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 9.3e-63 PFAM
PBPe 408 783 3.65e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094179
AA Change: N232K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524
AA Change: N232K

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 3.7e-69 PFAM
PBPe 408 783 2.09e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151045
AA Change: N163K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524
AA Change: N163K

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 303 4.7e-58 PFAM
PBPe 339 714 3.65e-121 SMART
Lig_chan-Glu_bd 349 414 1.65e-29 SMART
transmembrane domain 739 761 N/A INTRINSIC
low complexity region 794 805 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Gria1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Gria1 APN 11 57242941 nonsense probably null
IGL00807:Gria1 APN 11 57012040 missense probably benign
IGL00816:Gria1 APN 11 57317742 missense possibly damaging 0.93
IGL01110:Gria1 APN 11 57289381 missense probably damaging 1.00
IGL01116:Gria1 APN 11 57236975 missense probably damaging 1.00
IGL01120:Gria1 APN 11 57317669 missense probably damaging 0.99
IGL01843:Gria1 APN 11 57317774 missense probably damaging 1.00
IGL02135:Gria1 APN 11 57185853 missense probably damaging 1.00
IGL02308:Gria1 APN 11 57236924 missense probably benign 0.00
IGL02554:Gria1 APN 11 57289488 missense possibly damaging 0.72
IGL02813:Gria1 APN 11 57283584 missense probably damaging 1.00
IGL03071:Gria1 APN 11 57012110 unclassified probably null
IGL03326:Gria1 APN 11 57317773 missense probably damaging 1.00
PIT4445001:Gria1 UTSW 11 57185838 missense probably damaging 1.00
R0087:Gria1 UTSW 11 57317712 missense probably damaging 1.00
R0387:Gria1 UTSW 11 57309884 critical splice donor site probably null
R0399:Gria1 UTSW 11 57186027 missense probably damaging 0.97
R0502:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0503:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0549:Gria1 UTSW 11 57228973 missense probably damaging 1.00
R0590:Gria1 UTSW 11 57289409 missense probably damaging 1.00
R1395:Gria1 UTSW 11 57283566 missense probably damaging 1.00
R1422:Gria1 UTSW 11 57189788 missense probably benign 0.00
R1581:Gria1 UTSW 11 57237010 splice site probably null
R2002:Gria1 UTSW 11 57012104 missense possibly damaging 0.93
R2064:Gria1 UTSW 11 57317708 missense probably damaging 0.98
R2255:Gria1 UTSW 11 57185949 missense probably damaging 1.00
R2507:Gria1 UTSW 11 57289320 missense probably null 0.30
R2965:Gria1 UTSW 11 57185801 nonsense probably null
R3012:Gria1 UTSW 11 57289434 missense probably damaging 1.00
R3151:Gria1 UTSW 11 57283562 missense probably damaging 1.00
R3807:Gria1 UTSW 11 57310678 missense probably damaging 1.00
R5026:Gria1 UTSW 11 57310696 missense probably damaging 1.00
R5132:Gria1 UTSW 11 57289399 missense probably damaging 1.00
R5222:Gria1 UTSW 11 57189797 missense probably benign 0.22
R5303:Gria1 UTSW 11 57243025 missense probably benign 0.01
R5332:Gria1 UTSW 11 57327621 missense possibly damaging 0.93
R5413:Gria1 UTSW 11 57217794 missense probably benign 0.00
R5748:Gria1 UTSW 11 57309876 missense probably benign 0.00
R5878:Gria1 UTSW 11 57317802 critical splice donor site probably null
R5937:Gria1 UTSW 11 57189733 missense probably benign 0.00
R5995:Gria1 UTSW 11 57289285 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6180:Gria1 UTSW 11 57242792 missense probably damaging 1.00
R6187:Gria1 UTSW 11 57238110 missense possibly damaging 0.84
R6262:Gria1 UTSW 11 57242854 missense probably damaging 1.00
R6828:Gria1 UTSW 11 57289462 missense probably damaging 1.00
R7374:Gria1 UTSW 11 57189808 missense probably benign
R7507:Gria1 UTSW 11 57228939 missense probably benign 0.14
R7511:Gria1 UTSW 11 57283625 missense probably damaging 1.00
R7691:Gria1 UTSW 11 57236987 missense possibly damaging 0.94
R7898:Gria1 UTSW 11 57242765 missense probably damaging 1.00
R7981:Gria1 UTSW 11 57242765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCATGTGGTATGGATGCTCC -3'
(R):5'- TGAAAGGGAACTTGTGACCACTGTC -3'

Sequencing Primer
(F):5'- CAAGTAGCTGGTGGACATCA -3'
(R):5'- tgagcacacacaagggag -3'
Posted On2014-03-17