Incidental Mutation 'R1377:Slc38a6'
ID162919
Institutional Source Beutler Lab
Gene Symbol Slc38a6
Ensembl Gene ENSMUSG00000044712
Gene Namesolute carrier family 38, member 6
SynonymsEG625098
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1377 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location73286779-73354049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73350571 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 329 (I329N)
Ref Sequence ENSEMBL: ENSMUSP00000120810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140523]
Predicted Effect probably damaging
Transcript: ENSMUST00000140523
AA Change: I329N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120810
Gene: ENSMUSG00000044712
AA Change: I329N

DomainStartEndE-ValueType
Pfam:Aa_trans 44 452 2.5e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222671
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Slc38a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Slc38a6 APN 12 73351803 missense probably benign 0.00
IGL01083:Slc38a6 APN 12 73288493 missense possibly damaging 0.94
IGL01302:Slc38a6 APN 12 73288525 critical splice donor site probably null
IGL02106:Slc38a6 APN 12 73350546 missense possibly damaging 0.84
IGL02429:Slc38a6 APN 12 73350568 missense probably benign 0.18
IGL02815:Slc38a6 APN 12 73292205 missense probably damaging 1.00
IGL03001:Slc38a6 APN 12 73337053 missense probably benign 0.03
IGL03167:Slc38a6 APN 12 73350537 nonsense probably null
R0394:Slc38a6 UTSW 12 73352530 missense probably benign
R0918:Slc38a6 UTSW 12 73344785 splice site probably null
R1533:Slc38a6 UTSW 12 73344852 missense probably benign 0.11
R4171:Slc38a6 UTSW 12 73350552 missense probably benign 0.21
R4579:Slc38a6 UTSW 12 73288524 critical splice donor site probably null
R4864:Slc38a6 UTSW 12 73343650 intron probably null
R5162:Slc38a6 UTSW 12 73329985 missense possibly damaging 0.70
R5627:Slc38a6 UTSW 12 73343683 missense possibly damaging 0.59
R6189:Slc38a6 UTSW 12 73310196 missense probably damaging 1.00
R6302:Slc38a6 UTSW 12 73337075 missense probably damaging 1.00
R6407:Slc38a6 UTSW 12 73310175 missense probably damaging 1.00
R7289:Slc38a6 UTSW 12 73287012 missense probably benign
R7462:Slc38a6 UTSW 12 73350577 missense probably benign 0.15
R8031:Slc38a6 UTSW 12 73350603 missense probably benign 0.39
R8074:Slc38a6 UTSW 12 73344884 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ATGTGCAATGGCTCAGACACCC -3'
(R):5'- GTCCGTCGAGGCTCACTGTTATTTC -3'

Sequencing Primer
(F):5'- GCATACATCTCAGGACATGCTTAG -3'
(R):5'- GAGGTCTTGGATCAATTACCTGAC -3'
Posted On2014-03-17