Incidental Mutation 'R1377:Has2'
ID 162921
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Name hyaluronan synthase 2
Synonyms
MMRRC Submission 039441-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1377 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 56529023-56557935 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56545202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 133 (I133M)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
AlphaFold P70312
Predicted Effect probably damaging
Transcript: ENSMUST00000050544
AA Change: I133M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: I133M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 30,934,869 (GRCm39) V363A probably damaging Het
Arc G A 15: 74,544,101 (GRCm39) H41Y possibly damaging Het
Atp7b G A 8: 22,501,801 (GRCm39) A854V probably benign Het
Ccng1 G A 11: 40,642,941 (GRCm39) P169S probably benign Het
Dnah8 A T 17: 31,059,596 (GRCm39) K4399* probably null Het
Dscam A G 16: 96,573,694 (GRCm39) V756A probably damaging Het
Exoc3l4 A T 12: 111,395,104 (GRCm39) E574V probably damaging Het
Fbxo46 T A 7: 18,870,350 (GRCm39) V323E probably damaging Het
Gria1 C A 11: 57,092,002 (GRCm39) N163K probably damaging Het
Itgal T A 7: 126,921,089 (GRCm39) L750Q probably damaging Het
Ptprk G A 10: 28,462,022 (GRCm39) R1195Q probably benign Het
Rbm15 T C 3: 107,238,074 (GRCm39) T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Sipa1l2 T C 8: 126,218,716 (GRCm39) E207G probably damaging Het
Slc38a6 T A 12: 73,397,345 (GRCm39) I329N probably damaging Het
Stoml3 G A 3: 53,415,062 (GRCm39) A285T probably benign Het
Trhr2 C T 8: 123,087,327 (GRCm39) V38M probably damaging Het
Trp53bp1 A G 2: 121,101,123 (GRCm39) L25P probably damaging Het
Wdr33 T A 18: 32,021,694 (GRCm39) M748K unknown Het
Zfp454 T C 11: 50,764,607 (GRCm39) Y164C probably damaging Het
Zfp804a T C 2: 82,088,841 (GRCm39) V890A probably benign Het
Zxdc T C 6: 90,355,885 (GRCm39) S465P probably damaging Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56,545,072 (GRCm39) missense possibly damaging 0.51
IGL02027:Has2 APN 15 56,531,567 (GRCm39) missense probably damaging 1.00
IGL02178:Has2 APN 15 56,545,456 (GRCm39) missense probably damaging 1.00
IGL02493:Has2 APN 15 56,531,320 (GRCm39) missense probably damaging 1.00
IGL02533:Has2 APN 15 56,545,091 (GRCm39) missense probably benign 0.00
IGL03142:Has2 APN 15 56,545,491 (GRCm39) missense possibly damaging 0.92
IGL03240:Has2 APN 15 56,531,656 (GRCm39) missense probably damaging 1.00
R0189:Has2 UTSW 15 56,531,831 (GRCm39) missense probably damaging 1.00
R0362:Has2 UTSW 15 56,545,057 (GRCm39) missense probably damaging 1.00
R1762:Has2 UTSW 15 56,545,006 (GRCm39) missense probably benign 0.13
R1845:Has2 UTSW 15 56,531,974 (GRCm39) missense probably damaging 1.00
R2012:Has2 UTSW 15 56,531,264 (GRCm39) missense probably damaging 1.00
R2190:Has2 UTSW 15 56,531,183 (GRCm39) missense probably benign 0.00
R2656:Has2 UTSW 15 56,545,224 (GRCm39) missense possibly damaging 0.90
R2966:Has2 UTSW 15 56,545,533 (GRCm39) missense probably damaging 1.00
R4361:Has2 UTSW 15 56,545,344 (GRCm39) missense probably damaging 1.00
R5698:Has2 UTSW 15 56,531,312 (GRCm39) missense probably damaging 1.00
R5826:Has2 UTSW 15 56,531,498 (GRCm39) missense probably damaging 1.00
R5883:Has2 UTSW 15 56,531,459 (GRCm39) missense possibly damaging 0.49
R5942:Has2 UTSW 15 56,531,192 (GRCm39) nonsense probably null
R6433:Has2 UTSW 15 56,531,194 (GRCm39) missense possibly damaging 0.79
R6560:Has2 UTSW 15 56,531,660 (GRCm39) missense probably damaging 1.00
R6603:Has2 UTSW 15 56,531,968 (GRCm39) missense probably damaging 1.00
R7094:Has2 UTSW 15 56,545,017 (GRCm39) missense probably damaging 1.00
R7597:Has2 UTSW 15 56,531,817 (GRCm39) missense probably damaging 1.00
R7738:Has2 UTSW 15 56,531,108 (GRCm39) missense possibly damaging 0.89
R8060:Has2 UTSW 15 56,533,341 (GRCm39) missense probably benign 0.00
R8145:Has2 UTSW 15 56,545,175 (GRCm39) missense probably benign
R8915:Has2 UTSW 15 56,531,885 (GRCm39) missense probably damaging 1.00
R8964:Has2 UTSW 15 56,531,061 (GRCm39) missense probably damaging 0.96
R9144:Has2 UTSW 15 56,545,588 (GRCm39) missense probably benign 0.03
R9411:Has2 UTSW 15 56,531,306 (GRCm39) missense possibly damaging 0.62
R9416:Has2 UTSW 15 56,531,684 (GRCm39) missense probably damaging 1.00
R9551:Has2 UTSW 15 56,531,090 (GRCm39) missense probably benign 0.00
R9552:Has2 UTSW 15 56,531,090 (GRCm39) missense probably benign 0.00
Z1177:Has2 UTSW 15 56,544,979 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCCCTGGCAGGCATTTTCAGAC -3'
(R):5'- AAAACGGTAGCACTCTGCATCGC -3'

Sequencing Primer
(F):5'- GCAGGCATTTTCAGACCTACC -3'
(R):5'- ATCGCTGCGTACCAAGAG -3'
Posted On 2014-03-17