Incidental Mutation 'R1377:Arc'
ID162922
Institutional Source Beutler Lab
Gene Symbol Arc
Ensembl Gene ENSMUSG00000022602
Gene Nameactivity regulated cytoskeletal-associated protein
SynonymsArc3.1, arg 3.1
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1377 (G1)
Quality Score221
Status Not validated
Chromosome15
Chromosomal Location74669083-74672570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74672252 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 41 (H41Y)
Ref Sequence ENSEMBL: ENSMUSP00000105636 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000023268
AA Change: H41Y

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000110009
AA Change: H41Y

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in embryonic lethality around E6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Wdr33 T A 18: 31,888,641 M748K unknown Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Arc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Arc APN 15 74672355 missense probably benign
IGL02372:Arc APN 15 74672105 missense probably damaging 1.00
IGL03209:Arc APN 15 74671984 missense probably damaging 1.00
P0040:Arc UTSW 15 74671339 missense probably damaging 1.00
R0732:Arc UTSW 15 74671195 missense probably damaging 1.00
R2430:Arc UTSW 15 74671891 missense probably benign 0.01
R4647:Arc UTSW 15 74671525 missense probably damaging 1.00
R4855:Arc UTSW 15 74671743 missense probably benign 0.01
R6436:Arc UTSW 15 74672249 missense possibly damaging 0.47
R6743:Arc UTSW 15 74671787 missense probably benign
RF003:Arc UTSW 15 74672131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGACGGTAGAAGACCTCCC -3'
(R):5'- TTCTTAGCCTGTTCGGAGCCGC -3'

Sequencing Primer
(F):5'- ACGTGCATCTCACGCTTG -3'
(R):5'- CAGATGGAGCTGGACCATATGA -3'
Posted On2014-03-17