Incidental Mutation 'R1377:Wdr33'
ID162926
Institutional Source Beutler Lab
Gene Symbol Wdr33
Ensembl Gene ENSMUSG00000024400
Gene NameWD repeat domain 33
Synonyms2810021O11Rik, 1110001N06Rik, 8430413N20Rik, 2310011G05Rik, WDC146
MMRRC Submission 039441-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1377 (G1)
Quality Score125
Status Not validated
Chromosome18
Chromosomal Location31804057-31908987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31888641 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 748 (M748K)
Ref Sequence ENSEMBL: ENSMUSP00000025264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025264]
Predicted Effect unknown
Transcript: ENSMUST00000025264
AA Change: M748K
SMART Domains Protein: ENSMUSP00000025264
Gene: ENSMUSG00000024400
AA Change: M748K

DomainStartEndE-ValueType
WD40 107 147 2.15e-1 SMART
WD40 150 189 5.77e-5 SMART
WD40 191 230 1.89e-9 SMART
WD40 233 274 2.59e-7 SMART
WD40 277 316 2.73e-6 SMART
WD40 320 360 1.71e-7 SMART
WD40 364 403 1.52e-4 SMART
low complexity region 481 499 N/A INTRINSIC
coiled coil region 531 559 N/A INTRINSIC
low complexity region 573 587 N/A INTRINSIC
low complexity region 608 624 N/A INTRINSIC
low complexity region 628 668 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 725 761 N/A INTRINSIC
internal_repeat_1 778 803 3.47e-9 PROSPERO
low complexity region 806 818 N/A INTRINSIC
internal_repeat_1 821 845 3.47e-9 PROSPERO
low complexity region 848 881 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 938 951 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1041 1049 N/A INTRINSIC
low complexity region 1057 1100 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1190 1207 N/A INTRINSIC
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1287 1330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,116,051 V363A probably damaging Het
Arc G A 15: 74,672,252 H41Y possibly damaging Het
Atp7b G A 8: 22,011,785 A854V probably benign Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Dnah8 A T 17: 30,840,622 K4399* probably null Het
Dscam A G 16: 96,772,494 V756A probably damaging Het
Exoc3l4 A T 12: 111,428,670 E574V probably damaging Het
Fbxo46 T A 7: 19,136,425 V323E probably damaging Het
Gria1 C A 11: 57,201,176 N163K probably damaging Het
Has2 T C 15: 56,681,806 I133M probably damaging Het
Itgal T A 7: 127,321,917 L750Q probably damaging Het
Ptprk G A 10: 28,586,026 R1195Q probably benign Het
Rbm15 T C 3: 107,330,758 T775A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc38a6 T A 12: 73,350,571 I329N probably damaging Het
Stoml3 G A 3: 53,507,641 A285T probably benign Het
Trhr2 C T 8: 122,360,588 V38M probably damaging Het
Trp53bp1 A G 2: 121,270,642 L25P probably damaging Het
Zfp454 T C 11: 50,873,780 Y164C probably damaging Het
Zfp804a T C 2: 82,258,497 V890A probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Wdr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr33 APN 18 31878116 missense probably damaging 1.00
IGL01099:Wdr33 APN 18 31906789 unclassified probably benign
IGL01628:Wdr33 APN 18 31888310 missense unknown
IGL03296:Wdr33 APN 18 31827391 missense probably benign 0.03
R0103:Wdr33 UTSW 18 31833335 missense probably damaging 1.00
R0279:Wdr33 UTSW 18 31888324 missense unknown
R0563:Wdr33 UTSW 18 31886739 missense possibly damaging 0.94
R0730:Wdr33 UTSW 18 31835376 splice site probably benign
R1077:Wdr33 UTSW 18 31835461 missense probably benign 0.03
R1712:Wdr33 UTSW 18 31896631 missense unknown
R1855:Wdr33 UTSW 18 31906856 unclassified probably benign
R2013:Wdr33 UTSW 18 31888976 missense unknown
R2014:Wdr33 UTSW 18 31833599 missense probably damaging 1.00
R4497:Wdr33 UTSW 18 31893079 missense unknown
R4727:Wdr33 UTSW 18 31888447 missense unknown
R4739:Wdr33 UTSW 18 31886086 missense probably benign 0.17
R4777:Wdr33 UTSW 18 31881248 missense probably damaging 1.00
R4907:Wdr33 UTSW 18 31906993 makesense probably null
R5811:Wdr33 UTSW 18 31902620 missense unknown
R6053:Wdr33 UTSW 18 31878063 missense possibly damaging 0.93
R6454:Wdr33 UTSW 18 31829975 missense possibly damaging 0.47
R7112:Wdr33 UTSW 18 31893003 missense unknown
R7369:Wdr33 UTSW 18 31886666 missense probably benign 0.00
R7519:Wdr33 UTSW 18 31896770 missense unknown
RF014:Wdr33 UTSW 18 31881273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAAGGAATGCAGAGGCAC -3'
(R):5'- TCCCAGCAATCCACTTGGAGGATG -3'

Sequencing Primer
(F):5'- GGACCTCATGGCCCTTTG -3'
(R):5'- AATCCACTTGGAGGATGTGGTC -3'
Posted On2014-03-17