Incidental Mutation 'R1378:Ccna1'
ID162931
Institutional Source Beutler Lab
Gene Symbol Ccna1
Ensembl Gene ENSMUSG00000027793
Gene Namecyclin A1
Synonyms
MMRRC Submission 039442-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R1378 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location55045469-55055501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55049729 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 237 (V237A)
Ref Sequence ENSEMBL: ENSMUSP00000143447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029368] [ENSMUST00000197238] [ENSMUST00000198102] [ENSMUST00000198320] [ENSMUST00000199144] [ENSMUST00000199352]
Predicted Effect probably damaging
Transcript: ENSMUST00000029368
AA Change: V237A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029368
Gene: ENSMUSG00000027793
AA Change: V237A

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.8e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197238
AA Change: V237A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142692
Gene: ENSMUSG00000027793
AA Change: V237A

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.7e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198102
AA Change: V89A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142706
Gene: ENSMUSG00000027793
AA Change: V89A

DomainStartEndE-ValueType
CYCLIN 57 141 1.5e-32 SMART
Cyclin_C 150 250 3.6e-10 SMART
CYCLIN 154 238 2.2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198320
AA Change: V237A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143447
Gene: ENSMUSG00000027793
AA Change: V237A

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.7e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199144
Predicted Effect probably benign
Transcript: ENSMUST00000199352
Meta Mutation Damage Score 0.4774 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are infertile due to the arrest of spermatogenesis prior to the first meiotic division. Female mutant mice are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Edn2 A G 4: 120,161,898 E28G probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Gsdmc3 T C 15: 63,859,586 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Il23r T A 6: 67,452,410 K316I possibly damaging Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nlrp4d C A 7: 10,364,184 K850N probably benign Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr619 A T 7: 103,603,938 R95* probably null Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Pon3 T G 6: 5,230,813 D238A probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Ccna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccna1 APN 3 55050655 missense probably damaging 1.00
IGL00341:Ccna1 APN 3 55050655 missense probably damaging 1.00
IGL02484:Ccna1 APN 3 55048494 missense probably benign 0.08
IGL02649:Ccna1 APN 3 55054386 missense probably damaging 1.00
IGL03310:Ccna1 APN 3 55050620 missense probably benign 0.01
IGL03382:Ccna1 APN 3 55047277 missense probably damaging 1.00
R0127:Ccna1 UTSW 3 55049748 missense probably damaging 1.00
R0195:Ccna1 UTSW 3 55054364 missense probably damaging 0.99
R0219:Ccna1 UTSW 3 55050927 missense probably benign 0.00
R0255:Ccna1 UTSW 3 55050628 missense probably damaging 1.00
R0492:Ccna1 UTSW 3 55048583 missense probably damaging 0.98
R1102:Ccna1 UTSW 3 55050860 missense probably damaging 1.00
R3724:Ccna1 UTSW 3 55050932 missense probably damaging 0.99
R3799:Ccna1 UTSW 3 55050619 missense probably benign 0.24
R4199:Ccna1 UTSW 3 55047315 missense possibly damaging 0.85
R4992:Ccna1 UTSW 3 55049890 missense probably damaging 0.97
R5465:Ccna1 UTSW 3 55045644 missense probably benign 0.00
R5560:Ccna1 UTSW 3 55048569 missense probably damaging 1.00
R5603:Ccna1 UTSW 3 55050909 missense probably damaging 1.00
R6764:Ccna1 UTSW 3 55046078 missense probably damaging 1.00
R7034:Ccna1 UTSW 3 55046039 missense possibly damaging 0.67
R7144:Ccna1 UTSW 3 55045699 missense probably benign
R7944:Ccna1 UTSW 3 55050589 missense possibly damaging 0.68
R8088:Ccna1 UTSW 3 55051071 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAGCCAAGAGACTACAGGGCAG -3'
(R):5'- TACATGAGGAAGCAGCCGGACATC -3'

Sequencing Primer
(F):5'- GCAGAGCAGAGTTCCATCTTG -3'
(R):5'- AGCCGGACATCACGGAG -3'
Posted On2014-03-17