Incidental Mutation 'R1378:Vmn2r7'
ID162932
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission 039442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1378 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64691604 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 511 (S511P)
Ref Sequence ENSEMBL: ENSMUSP00000131220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000161972
AA Change: S602P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: S602P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168072
AA Change: S511P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028
AA Change: S511P

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177146
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Ccna1 A G 3: 55,049,729 V237A probably damaging Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Edn2 A G 4: 120,161,898 E28G probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Gsdmc3 T C 15: 63,859,586 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Il23r T A 6: 67,452,410 K316I possibly damaging Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nlrp4d C A 7: 10,364,184 K850N probably benign Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr619 A T 7: 103,603,938 R95* probably null Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Pon3 T G 6: 5,230,813 D238A probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAGAGACACCTGAATGAGGAAG -3'
(R):5'- TGTCACATCATCTGCACCAAGGC -3'

Sequencing Primer
(F):5'- CCTGAATGAGGAAGCTCAGCTC -3'
(R):5'- GCACCAAGGCCCCTTTTATAA -3'
Posted On2014-03-17