Incidental Mutation 'R1378:Edn2'
ID162933
Institutional Source Beutler Lab
Gene Symbol Edn2
Ensembl Gene ENSMUSG00000028635
Gene Nameendothelin 2
SynonymsVIC, vasoactive intestinal contractor peptide
MMRRC Submission 039442-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1378 (G1)
Quality Score166
Status Validated
Chromosome4
Chromosomal Location120161206-120167360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120161898 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 28 (E28G)
Ref Sequence ENSEMBL: ENSMUSP00000030384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030384]
Predicted Effect probably benign
Transcript: ENSMUST00000030384
AA Change: E28G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000030384
Gene: ENSMUSG00000028635
AA Change: E28G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
END 45 66 1.5e-8 SMART
low complexity region 81 87 N/A INTRINSIC
END 92 113 1.49e-3 SMART
low complexity region 115 127 N/A INTRINSIC
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a member of the endothelin family of peptides. The encoded preproprotein undergoes proteolytic processing to generate a potent vasoconstrictive peptide. This gene is abundantly expressed in the gastrointestinal tract, strongly induced in photorecepteror cells in retinal diseases and injury, and produced by microglia and macrophages in the early stages of glaucoma. Mice lacking the encoded protein exhibit severe growth retardation, hypothermia and juvenile lethality. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, hypothermia, hypoxemic hypoxia, hypercapnia, emphysema and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Ccna1 A G 3: 55,049,729 V237A probably damaging Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Gsdmc3 T C 15: 63,859,586 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Il23r T A 6: 67,452,410 K316I possibly damaging Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nlrp4d C A 7: 10,364,184 K850N probably benign Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr619 A T 7: 103,603,938 R95* probably null Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Pon3 T G 6: 5,230,813 D238A probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Edn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Edn2 APN 4 120163452 missense probably damaging 1.00
IGL02243:Edn2 APN 4 120162032 splice site probably null
IGL03295:Edn2 APN 4 120161981 missense probably damaging 1.00
R0613:Edn2 UTSW 4 120161864 splice site probably null
R7272:Edn2 UTSW 4 120161946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGTGGTTCCTGAACACCAAG -3'
(R):5'- AGCCCTCTGCCTGACTCTAATAGC -3'

Sequencing Primer
(F):5'- AAGGGTGCCAACTTCCTTATTG -3'
(R):5'- CCTGAGATTCAGGGTGAGCAC -3'
Posted On2014-03-17