Incidental Mutation 'R1378:Nlrp4d'
ID162946
Institutional Source Beutler Lab
Gene Symbol Nlrp4d
Ensembl Gene ENSMUSG00000034122
Gene NameNLR family, pyrin domain containing 4D
SynonymsNalp4d, Nalp-beta
MMRRC Submission 039442-MU
Accession Numbers

Genbank: XM_001481310; Ensembl: ENSMUST00000184509

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1378 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10358862-10388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10364184 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 850 (K850N)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000086269
AA Change: K850N

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083450
Gene: ENSMUSG00000034122
AA Change: K850N

DomainStartEndE-ValueType
PYRIN 6 89 2.6e-31 SMART
Pfam:NACHT 150 318 2.4e-34 PFAM
low complexity region 575 586 N/A INTRINSIC
LRR 674 701 1.3e-1 SMART
Blast:LRR 703 729 8e-7 BLAST
LRR 730 756 2.1e-2 SMART
LRR 758 785 2.1e-1 SMART
LRR 786 813 1.6e-5 SMART
LRR 814 837 3.5e-1 SMART
LRR 838 865 2.7e-6 SMART
LRR 867 894 7.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Ccna1 A G 3: 55,049,729 V237A probably damaging Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Edn2 A G 4: 120,161,898 E28G probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Gsdmc3 T C 15: 63,859,586 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Il23r T A 6: 67,452,410 K316I possibly damaging Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr619 A T 7: 103,603,938 R95* probably null Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Pon3 T G 6: 5,230,813 D238A probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Nlrp4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nlrp4d APN 7 10382094 exon noncoding transcript
IGL01076:Nlrp4d APN 7 10372083 missense unknown 0.00
IGL01656:Nlrp4d APN 7 10364147 missense noncoding transcript
IGL01889:Nlrp4d APN 7 10378334 missense unknown 0.00
IGL02110:Nlrp4d APN 7 10382564 exon noncoding transcript
IGL02271:Nlrp4d APN 7 10388698 exon noncoding transcript
IGL02637:Nlrp4d APN 7 10382555 exon noncoding transcript
snoop UTSW 7 10374891 missense probably benign 0.02
1mM(1):Nlrp4d UTSW 7 10381713 missense probably benign 0.09
F5493:Nlrp4d UTSW 7 10381084 missense possibly damaging 0.84
IGL03048:Nlrp4d UTSW 7 10358954 unclassified noncoding transcript
R0116:Nlrp4d UTSW 7 10374891 missense probably benign 0.02
R0125:Nlrp4d UTSW 7 10382389 missense probably damaging 1.00
R0390:Nlrp4d UTSW 7 10388778 missense probably benign 0.04
R0452:Nlrp4d UTSW 7 10378292 missense probably benign 0.01
R0595:Nlrp4d UTSW 7 10381045 missense probably benign 0.00
R0729:Nlrp4d UTSW 7 10377685 critical splice donor site probably benign
R0733:Nlrp4d UTSW 7 10382522 missense probably benign 0.02
R1147:Nlrp4d UTSW 7 10388717 missense probably benign 0.00
R1217:Nlrp4d UTSW 7 10364267 missense probably benign 0.36
R1414:Nlrp4d UTSW 7 10382601 missense probably benign 0.22
R1583:Nlrp4d UTSW 7 10382237 missense probably damaging 0.99
R1585:Nlrp4d UTSW 7 10382510 missense probably benign 0.02
R1882:Nlrp4d UTSW 7 10382677 critical splice acceptor site noncoding transcript
R2422:Nlrp4d UTSW 7 10362945 missense probably benign 0.29
R2907:Nlrp4d UTSW 7 10378427 missense probably benign 0.00
R2964:Nlrp4d UTSW 7 10378329 nonsense probably null
R2974:Nlrp4d UTSW 7 10378440 critical splice acceptor site probably benign
R3401:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R3402:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R4240:Nlrp4d UTSW 7 10381316 missense noncoding transcript
R4682:Nlrp4d UTSW 7 10374952 missense noncoding transcript
R4766:Nlrp4d UTSW 7 10362779 critical splice donor site unknown
R4864:Nlrp4d UTSW 7 10381161 missense noncoding transcript
R4910:Nlrp4d UTSW 7 10378409 exon noncoding transcript
R5307:Nlrp4d UTSW 7 10362782 nonsense probably null
R5596:Nlrp4d UTSW 7 10382024 missense noncoding transcript
R5857:Nlrp4d UTSW 7 10382377 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- CATGCATCTTATGCATCCACGCATC -3'
(R):5'- TCTTCTTCAGATCAGGGAGTAACCACTG -3'

Sequencing Primer
(F):5'- ttctaagccacctcttcagtc -3'
(R):5'- TCAGGGAGTAACCACTGTATTG -3'
Posted On2014-03-17