Incidental Mutation 'R1378:Olfr619'
ID 162949
Institutional Source Beutler Lab
Gene Symbol Olfr619
Ensembl Gene ENSMUSG00000073944
Gene Name olfactory receptor 619
Synonyms MOR31-5, GA_x6K02T2PBJ9-6326488-6327450
MMRRC Submission 039442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R1378 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103600575-103604859 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 103603938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 95 (R95*)
Ref Sequence ENSEMBL: ENSMUSP00000150630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098196] [ENSMUST00000214883] [ENSMUST00000215732] [ENSMUST00000217603]
AlphaFold E9PV95
Predicted Effect probably null
Transcript: ENSMUST00000098196
AA Change: R95*
SMART Domains Protein: ENSMUSP00000095798
Gene: ENSMUSG00000073944
AA Change: R95*

DomainStartEndE-ValueType
Pfam:7tm_4 36 316 4.4e-106 PFAM
Pfam:7TM_GPCR_Srsx 40 265 5e-10 PFAM
Pfam:7tm_1 46 298 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214883
Predicted Effect probably null
Transcript: ENSMUST00000215732
AA Change: R95*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215752
Predicted Effect probably benign
Transcript: ENSMUST00000217603
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik G T 7: 118,794,572 E515* probably null Het
9030624J02Rik A T 7: 118,794,573 E515V probably damaging Het
Afap1 A G 5: 35,968,686 T342A probably damaging Het
Alg1 A G 16: 5,243,716 N406D probably damaging Het
Atp13a4 A T 16: 29,420,428 M825K probably damaging Het
BC100530 A G 16: 36,359,567 C63R probably benign Het
Birc6 T A 17: 74,660,455 I4117K probably damaging Het
Brinp2 A T 1: 158,247,054 L499Q possibly damaging Het
Brwd1 A T 16: 96,041,370 V789D probably benign Het
Ccdc153 C G 9: 44,243,661 L94V probably null Het
Ccna1 A G 3: 55,049,729 V237A probably damaging Het
Cct7 T A 6: 85,467,563 probably null Het
Cenpb C T 2: 131,178,310 probably benign Het
Chrne T A 11: 70,615,130 probably null Het
Clstn3 T A 6: 124,438,419 D662V probably damaging Het
Clu G T 14: 65,974,901 C189F probably damaging Het
Cul7 C T 17: 46,662,126 R1388C probably damaging Het
Dgka T C 10: 128,735,827 probably null Het
Dopey2 A G 16: 93,770,392 T1236A probably benign Het
Edn2 A G 4: 120,161,898 E28G probably benign Het
Elp3 T C 14: 65,592,931 I24V probably benign Het
Faap24 T C 7: 35,392,901 E197G probably benign Het
Fam13a T A 6: 58,956,751 M285L probably benign Het
Gm1966 T A 7: 106,602,166 I624F probably damaging Het
Gm9944 T A 4: 144,453,203 probably benign Het
Gsdmc3 T C 15: 63,859,586 probably benign Het
Ift22 A C 5: 136,912,903 K133T probably benign Het
Il23r T A 6: 67,452,410 K316I possibly damaging Het
Klra17 T A 6: 129,865,684 E217V probably damaging Het
Nell2 A T 15: 95,232,521 V657E probably damaging Het
Nlrp4d C A 7: 10,364,184 K850N probably benign Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Olfr1208 T A 2: 88,897,026 R190S probably benign Het
Olfr591 T C 7: 103,173,268 D123G probably damaging Het
Olfr963 T C 9: 39,669,666 L203P probably damaging Het
Pclo T C 5: 14,682,313 S3610P probably benign Het
Pon3 T G 6: 5,230,813 D238A probably benign Het
Ppp4r4 T C 12: 103,581,492 probably benign Het
Rad18 T C 6: 112,681,336 probably benign Het
Ralgapa1 T C 12: 55,676,926 Y1652C probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sel1l T C 12: 91,833,097 probably null Het
Soat1 A G 1: 156,466,782 probably benign Het
Tex15 A T 8: 33,575,216 N1558I probably damaging Het
Tmem132d A T 5: 128,268,947 F170L probably benign Het
Tro G T X: 150,655,571 P30Q probably damaging Het
Tubg2 G T 11: 101,156,873 E95* probably null Het
Unc45b G A 11: 82,936,852 S725N probably benign Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Zfp174 G A 16: 3,849,489 E181K probably benign Het
Other mutations in Olfr619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Olfr619 APN 7 103604067 missense probably benign 0.23
IGL01806:Olfr619 APN 7 103604341 missense probably benign 0.21
IGL01934:Olfr619 APN 7 103603975 missense probably damaging 1.00
IGL02269:Olfr619 APN 7 103603882 missense probably damaging 0.98
IGL03049:Olfr619 APN 7 103604091 missense probably damaging 0.99
IGL03165:Olfr619 APN 7 103604011 missense probably damaging 0.98
IGL03338:Olfr619 APN 7 103604408 nonsense probably null
R1660:Olfr619 UTSW 7 103603675 nonsense probably null
R1975:Olfr619 UTSW 7 103604012 splice site probably null
R1985:Olfr619 UTSW 7 103603672 missense probably benign
R2249:Olfr619 UTSW 7 103603736 missense probably benign 0.00
R2423:Olfr619 UTSW 7 103604034 missense probably benign 0.14
R4005:Olfr619 UTSW 7 103604263 missense probably damaging 1.00
R4931:Olfr619 UTSW 7 103604374 missense probably benign 0.01
R4939:Olfr619 UTSW 7 103604251 missense probably benign 0.12
R4942:Olfr619 UTSW 7 103604194 missense probably benign
R4970:Olfr619 UTSW 7 103603990 missense probably damaging 0.98
R4993:Olfr619 UTSW 7 103603656 start codon destroyed probably benign 0.01
R5254:Olfr619 UTSW 7 103603789 missense probably benign 0.19
R6001:Olfr619 UTSW 7 103603972 missense probably damaging 1.00
R6905:Olfr619 UTSW 7 103604367 missense probably benign
R6985:Olfr619 UTSW 7 103603668 missense probably benign 0.00
R8253:Olfr619 UTSW 7 103604331 missense possibly damaging 0.88
R9124:Olfr619 UTSW 7 103603656 start codon destroyed probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAGATGCACACATTTGGCTCTCC -3'
(R):5'- AGTGACGAATGATGCTCTTCCCAC -3'

Sequencing Primer
(F):5'- ACACATTTGGCTCTCCATCCC -3'
(R):5'- ATGCTCTTCCCACAATAGGTGAG -3'
Posted On 2014-03-17