Incidental Mutation 'R1381:Dennd4c'
ID162998
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
MMRRC Submission 039443-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1381 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86774532 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 93 (R93K)
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably benign
Transcript: ENSMUST00000045512
AA Change: R93K

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: R93K

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082026
AA Change: R93K

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: R93K

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128710
Predicted Effect probably benign
Transcript: ENSMUST00000142837
AA Change: R93K

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: R93K

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,731,086 F252L probably benign Het
Aadac A T 3: 60,039,930 M350L probably damaging Het
Agtrap G A 4: 148,083,965 T19I probably damaging Het
Apba3 C T 10: 81,271,756 T142M possibly damaging Het
Cd55b T A 1: 130,419,675 K133I probably damaging Het
Cep295 A C 9: 15,322,565 C2312G probably benign Het
Ces1a A G 8: 93,034,031 V231A probably damaging Het
Chdh C A 14: 30,036,834 L579I probably damaging Het
Cyb5r4 T A 9: 87,022,233 S19T probably benign Het
Cyp2d22 C A 15: 82,372,508 R355L probably benign Het
Dach2 T C X: 113,298,775 Y117H probably damaging Het
Dph2 G T 4: 117,889,668 L452I probably damaging Het
Exoc6b T C 6: 84,835,117 D634G probably benign Het
Fam217b G A 2: 178,420,425 V61I probably benign Het
Fbln7 A C 2: 128,877,379 Q32P probably damaging Het
Fgfr1op2 A G 6: 146,588,741 Y46C probably damaging Het
Fhod3 T A 18: 25,090,471 I958N probably damaging Het
Foxp2 T A 6: 15,409,766 M455K possibly damaging Het
Gabrr2 G A 4: 33,081,420 G152D probably damaging Het
Galntl6 G T 8: 58,472,955 P92Q probably damaging Het
Gm5592 A T 7: 41,286,172 T33S probably benign Het
Grid2ip A T 5: 143,362,651 T166S probably benign Het
Grsf1 G A 5: 88,665,864 S225L probably benign Het
Hadha G T 5: 30,128,836 T395K probably benign Het
Hars2 C T 18: 36,789,217 A295V possibly damaging Het
Hsf5 T A 11: 87,638,169 S577T probably benign Het
Ice2 A G 9: 69,400,527 Y31C probably damaging Het
Ift80 A T 3: 68,914,783 I643N possibly damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Ilvbl C A 10: 78,576,596 S50R probably damaging Het
Invs C A 4: 48,421,942 S858* probably null Het
Ipo13 T G 4: 117,904,395 T508P probably damaging Het
Itgb4 T C 11: 115,994,337 I1015T probably benign Het
Kank4 A T 4: 98,779,938 W91R probably damaging Het
Kansl1l C T 1: 66,720,904 A906T probably benign Het
Klk4 G A 7: 43,885,282 V222M probably damaging Het
Lipo4 T A 19: 33,499,341 M336L probably benign Het
Lrig1 T C 6: 94,606,130 N1002D probably benign Het
Lzts3 A G 2: 130,635,299 S524P probably damaging Het
Maz A T 7: 127,023,152 C409* probably null Het
Mmp24 A T 2: 155,814,127 Q495L possibly damaging Het
Mrgpra9 C T 7: 47,235,302 V206I possibly damaging Het
Myof A G 19: 37,995,485 Y124H probably damaging Het
Nalcn A T 14: 123,314,105 V1030D probably damaging Het
Neb T A 2: 52,260,532 I2495F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nup153 T C 13: 46,689,181 D837G probably damaging Het
Nup210 C A 6: 91,075,960 G331V probably damaging Het
Olfr1143 T C 2: 87,803,136 L245P probably damaging Het
Olfr1447 T C 19: 12,900,956 T275A probably benign Het
Olfr5 A G 7: 6,481,009 probably null Het
Olfr923 T A 9: 38,828,338 S210T probably benign Het
Pabpc4 T A 4: 123,289,059 L163H probably damaging Het
Papd5 T A 8: 88,243,309 M203K possibly damaging Het
Pcdh7 T A 5: 57,721,540 Y126* probably null Het
Pdzd2 A G 15: 12,385,439 S1082P probably benign Het
Pkd2l1 T C 19: 44,150,463 I649M probably benign Het
Plcl2 G A 17: 50,607,729 E589K probably damaging Het
Plppr1 C A 4: 49,337,674 T325N possibly damaging Het
Pqlc1 T G 18: 80,283,314 S126A probably benign Het
Prss8 GCTGCCCAAGTCCC GC 7: 127,929,849 probably benign Het
Ptcd2 A G 13: 99,344,597 S25P probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rusc2 T A 4: 43,416,137 V481E probably damaging Het
Sephs2 G T 7: 127,272,967 T318K probably damaging Het
Sf3b1 T A 1: 55,003,154 I497L probably damaging Het
Slc30a7 C T 3: 115,956,870 probably null Het
Smarca2 T C 19: 26,630,828 S96P probably damaging Het
Spata31d1c A C 13: 65,036,554 I637L probably benign Het
Ston2 A T 12: 91,740,492 S115T probably damaging Het
Tal2 A C 4: 53,785,999 E60A probably benign Het
Tdpoz3 A T 3: 93,826,140 T41S probably benign Het
Tespa1 T C 10: 130,360,691 I166T probably benign Het
Thsd7a A T 6: 12,555,439 C149S probably damaging Het
Trav6-1 T A 14: 52,638,510 probably benign Het
Txnl4a T C 18: 80,207,264 V25A probably benign Het
Utp4 C A 8: 106,906,276 P297Q probably benign Het
Vmn1r34 T C 6: 66,636,938 Y272C probably damaging Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Vmn2r121 C A X: 124,128,140 G728W probably damaging Het
Vmn2r24 T A 6: 123,786,733 S190T probably damaging Het
Zfp507 A G 7: 35,776,010 V926A possibly damaging Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
Predicted Primers PCR Primer
(F):5'- AGCTCCAATCACAGACATTGCTGTTAT -3'
(R):5'- GGAATGCCCTTCCCTAAAGATGTTCAT -3'

Sequencing Primer
(F):5'- CAGCACTCCAAGCAAACTTG -3'
(R):5'- agcactgactcctctccc -3'
Posted On2014-03-17