Incidental Mutation 'R1381:Ipo13'
ID163002
Institutional Source Beutler Lab
Gene Symbol Ipo13
Ensembl Gene ENSMUSG00000033365
Gene Nameimportin 13
SynonymsKap13
MMRRC Submission 039443-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1381 (G1)
Quality Score125
Status Not validated
Chromosome4
Chromosomal Location117894486-117914999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 117904395 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 508 (T508P)
Ref Sequence ENSEMBL: ENSMUSP00000035989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036156]
Predicted Effect probably damaging
Transcript: ENSMUST00000036156
AA Change: T508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: T508P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153918
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,731,086 F252L probably benign Het
Aadac A T 3: 60,039,930 M350L probably damaging Het
Agtrap G A 4: 148,083,965 T19I probably damaging Het
Apba3 C T 10: 81,271,756 T142M possibly damaging Het
Cd55b T A 1: 130,419,675 K133I probably damaging Het
Cep295 A C 9: 15,322,565 C2312G probably benign Het
Ces1a A G 8: 93,034,031 V231A probably damaging Het
Chdh C A 14: 30,036,834 L579I probably damaging Het
Cyb5r4 T A 9: 87,022,233 S19T probably benign Het
Cyp2d22 C A 15: 82,372,508 R355L probably benign Het
Dach2 T C X: 113,298,775 Y117H probably damaging Het
Dennd4c G A 4: 86,774,532 R93K probably benign Het
Dph2 G T 4: 117,889,668 L452I probably damaging Het
Exoc6b T C 6: 84,835,117 D634G probably benign Het
Fam217b G A 2: 178,420,425 V61I probably benign Het
Fbln7 A C 2: 128,877,379 Q32P probably damaging Het
Fgfr1op2 A G 6: 146,588,741 Y46C probably damaging Het
Fhod3 T A 18: 25,090,471 I958N probably damaging Het
Foxp2 T A 6: 15,409,766 M455K possibly damaging Het
Gabrr2 G A 4: 33,081,420 G152D probably damaging Het
Galntl6 G T 8: 58,472,955 P92Q probably damaging Het
Gm5592 A T 7: 41,286,172 T33S probably benign Het
Grid2ip A T 5: 143,362,651 T166S probably benign Het
Grsf1 G A 5: 88,665,864 S225L probably benign Het
Hadha G T 5: 30,128,836 T395K probably benign Het
Hars2 C T 18: 36,789,217 A295V possibly damaging Het
Hsf5 T A 11: 87,638,169 S577T probably benign Het
Ice2 A G 9: 69,400,527 Y31C probably damaging Het
Ift80 A T 3: 68,914,783 I643N possibly damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Ilvbl C A 10: 78,576,596 S50R probably damaging Het
Invs C A 4: 48,421,942 S858* probably null Het
Itgb4 T C 11: 115,994,337 I1015T probably benign Het
Kank4 A T 4: 98,779,938 W91R probably damaging Het
Kansl1l C T 1: 66,720,904 A906T probably benign Het
Klk4 G A 7: 43,885,282 V222M probably damaging Het
Lipo4 T A 19: 33,499,341 M336L probably benign Het
Lrig1 T C 6: 94,606,130 N1002D probably benign Het
Lzts3 A G 2: 130,635,299 S524P probably damaging Het
Maz A T 7: 127,023,152 C409* probably null Het
Mmp24 A T 2: 155,814,127 Q495L possibly damaging Het
Mrgpra9 C T 7: 47,235,302 V206I possibly damaging Het
Myof A G 19: 37,995,485 Y124H probably damaging Het
Nalcn A T 14: 123,314,105 V1030D probably damaging Het
Neb T A 2: 52,260,532 I2495F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nup153 T C 13: 46,689,181 D837G probably damaging Het
Nup210 C A 6: 91,075,960 G331V probably damaging Het
Olfr1143 T C 2: 87,803,136 L245P probably damaging Het
Olfr1447 T C 19: 12,900,956 T275A probably benign Het
Olfr5 A G 7: 6,481,009 probably null Het
Olfr923 T A 9: 38,828,338 S210T probably benign Het
Pabpc4 T A 4: 123,289,059 L163H probably damaging Het
Papd5 T A 8: 88,243,309 M203K possibly damaging Het
Pcdh7 T A 5: 57,721,540 Y126* probably null Het
Pdzd2 A G 15: 12,385,439 S1082P probably benign Het
Pkd2l1 T C 19: 44,150,463 I649M probably benign Het
Plcl2 G A 17: 50,607,729 E589K probably damaging Het
Plppr1 C A 4: 49,337,674 T325N possibly damaging Het
Pqlc1 T G 18: 80,283,314 S126A probably benign Het
Prss8 GCTGCCCAAGTCCC GC 7: 127,929,849 probably benign Het
Ptcd2 A G 13: 99,344,597 S25P probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rusc2 T A 4: 43,416,137 V481E probably damaging Het
Sephs2 G T 7: 127,272,967 T318K probably damaging Het
Sf3b1 T A 1: 55,003,154 I497L probably damaging Het
Slc30a7 C T 3: 115,956,870 probably null Het
Smarca2 T C 19: 26,630,828 S96P probably damaging Het
Spata31d1c A C 13: 65,036,554 I637L probably benign Het
Ston2 A T 12: 91,740,492 S115T probably damaging Het
Tal2 A C 4: 53,785,999 E60A probably benign Het
Tdpoz3 A T 3: 93,826,140 T41S probably benign Het
Tespa1 T C 10: 130,360,691 I166T probably benign Het
Thsd7a A T 6: 12,555,439 C149S probably damaging Het
Trav6-1 T A 14: 52,638,510 probably benign Het
Txnl4a T C 18: 80,207,264 V25A probably benign Het
Utp4 C A 8: 106,906,276 P297Q probably benign Het
Vmn1r34 T C 6: 66,636,938 Y272C probably damaging Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Vmn2r121 C A X: 124,128,140 G728W probably damaging Het
Vmn2r24 T A 6: 123,786,733 S190T probably damaging Het
Zfp507 A G 7: 35,776,010 V926A possibly damaging Het
Other mutations in Ipo13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ipo13 APN 4 117903405 missense probably benign 0.10
IGL00800:Ipo13 APN 4 117912308 missense probably benign 0.31
IGL00971:Ipo13 APN 4 117914367 missense possibly damaging 0.83
IGL01552:Ipo13 APN 4 117900964 missense probably benign 0.16
IGL01957:Ipo13 APN 4 117903881 missense probably damaging 0.99
IGL02262:Ipo13 APN 4 117903813 missense probably damaging 1.00
R0109:Ipo13 UTSW 4 117905016 missense possibly damaging 0.92
R0142:Ipo13 UTSW 4 117905569 missense probably damaging 1.00
R0771:Ipo13 UTSW 4 117894646 missense possibly damaging 0.78
R1248:Ipo13 UTSW 4 117901031 missense probably damaging 1.00
R1497:Ipo13 UTSW 4 117904659 missense probably benign 0.04
R1614:Ipo13 UTSW 4 117904618 missense probably benign 0.00
R1711:Ipo13 UTSW 4 117904522 missense probably benign 0.38
R2037:Ipo13 UTSW 4 117904661 nonsense probably null
R2200:Ipo13 UTSW 4 117904903 critical splice donor site probably null
R3698:Ipo13 UTSW 4 117900693 missense probably damaging 1.00
R3949:Ipo13 UTSW 4 117901042 missense probably benign 0.10
R4687:Ipo13 UTSW 4 117901576 missense probably benign 0.06
R4894:Ipo13 UTSW 4 117903441 missense probably damaging 0.99
R4894:Ipo13 UTSW 4 117904490 missense possibly damaging 0.84
R4956:Ipo13 UTSW 4 117901571 missense probably benign 0.00
R5679:Ipo13 UTSW 4 117894832 missense probably damaging 1.00
R5879:Ipo13 UTSW 4 117903203 missense possibly damaging 0.67
R5921:Ipo13 UTSW 4 117912089 missense probably benign 0.14
R6250:Ipo13 UTSW 4 117912154 missense possibly damaging 0.93
R6875:Ipo13 UTSW 4 117904911 missense possibly damaging 0.90
R7178:Ipo13 UTSW 4 117903884 missense possibly damaging 0.83
R7412:Ipo13 UTSW 4 117894871 missense probably benign
R7687:Ipo13 UTSW 4 117911891 missense probably benign 0.01
R7774:Ipo13 UTSW 4 117914297 missense probably benign 0.11
Z1088:Ipo13 UTSW 4 117904680 missense probably benign 0.14
Z1176:Ipo13 UTSW 4 117904630 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACTGACAGCAGATTAGCATCGC -3'
(R):5'- TTGCACCCTTCATCTAAGTCAAGCC -3'

Sequencing Primer
(F):5'- TTAGCATCGCTGAGATGAAGCTC -3'
(R):5'- TTGCAGAGACCATCGATGTC -3'
Posted On2014-03-17