Mutagenetix > Incidental Mutations

Incidental Mutation 'R1381:Cep295'

163034

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

039443-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R1381 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 15322565 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 2312 (C2312G)

Ref Sequence

ENSEMBL: ENSMUSP00000123788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000058041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

probably benign
Transcript: ENSMUST00000098979
AA Change: C2232G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: C2232G

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104318

Predicted Effect

probably benign
Transcript: ENSMUST00000159156

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160238

Predicted Effect

unknown
Transcript: ENSMUST00000160946
AA Change: C1056G

SMART Domains

Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: C1056G

Domain	Start	End	E-Value	Type
coiled coil region	92	119	N/A	INTRINSIC
low complexity region	282	293	N/A	INTRINSIC
low complexity region	356	370	N/A	INTRINSIC
coiled coil region	451	480	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161132
AA Change: C2312G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: C2312G

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161533

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: C2184G

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162264

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214427

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217407

Predicted Effect

probably benign
Transcript: ENSMUST00000217140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214696

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.4%
20x: 86.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	C	A	2: 68,731,086	F252L	probably benign	Het
Aadac	A	T	3: 60,039,930	M350L	probably damaging	Het
Agtrap	G	A	4: 148,083,965	T19I	probably damaging	Het
Apba3	C	T	10: 81,271,756	T142M	possibly damaging	Het
Cd55b	T	A	1: 130,419,675	K133I	probably damaging	Het
Ces1a	A	G	8: 93,034,031	V231A	probably damaging	Het
Chdh	C	A	14: 30,036,834	L579I	probably damaging	Het
Cyb5r4	T	A	9: 87,022,233	S19T	probably benign	Het
Cyp2d22	C	A	15: 82,372,508	R355L	probably benign	Het
Dach2	T	C	X: 113,298,775	Y117H	probably damaging	Het
Dennd4c	G	A	4: 86,774,532	R93K	probably benign	Het
Dph2	G	T	4: 117,889,668	L452I	probably damaging	Het
Exoc6b	T	C	6: 84,835,117	D634G	probably benign	Het
Fam217b	G	A	2: 178,420,425	V61I	probably benign	Het
Fbln7	A	C	2: 128,877,379	Q32P	probably damaging	Het
Fgfr1op2	A	G	6: 146,588,741	Y46C	probably damaging	Het
Fhod3	T	A	18: 25,090,471	I958N	probably damaging	Het
Foxp2	T	A	6: 15,409,766	M455K	possibly damaging	Het
Gabrr2	G	A	4: 33,081,420	G152D	probably damaging	Het
Galntl6	G	T	8: 58,472,955	P92Q	probably damaging	Het
Gm5592	A	T	7: 41,286,172	T33S	probably benign	Het
Grid2ip	A	T	5: 143,362,651	T166S	probably benign	Het
Grsf1	G	A	5: 88,665,864	S225L	probably benign	Het
Hadha	G	T	5: 30,128,836	T395K	probably benign	Het
Hars2	C	T	18: 36,789,217	A295V	possibly damaging	Het
Hsf5	T	A	11: 87,638,169	S577T	probably benign	Het
Ice2	A	G	9: 69,400,527	Y31C	probably damaging	Het
Ift80	A	T	3: 68,914,783	I643N	possibly damaging	Het
Iglon5	A	T	7: 43,476,640	D222E	probably benign	Het
Ilvbl	C	A	10: 78,576,596	S50R	probably damaging	Het
Invs	C	A	4: 48,421,942	S858*	probably null	Het
Ipo13	T	G	4: 117,904,395	T508P	probably damaging	Het
Itgb4	T	C	11: 115,994,337	I1015T	probably benign	Het
Kank4	A	T	4: 98,779,938	W91R	probably damaging	Het
Kansl1l	C	T	1: 66,720,904	A906T	probably benign	Het
Klk4	G	A	7: 43,885,282	V222M	probably damaging	Het
Lipo4	T	A	19: 33,499,341	M336L	probably benign	Het
Lrig1	T	C	6: 94,606,130	N1002D	probably benign	Het
Lzts3	A	G	2: 130,635,299	S524P	probably damaging	Het
Maz	A	T	7: 127,023,152	C409*	probably null	Het
Mmp24	A	T	2: 155,814,127	Q495L	possibly damaging	Het
Mrgpra9	C	T	7: 47,235,302	V206I	possibly damaging	Het
Myof	A	G	19: 37,995,485	Y124H	probably damaging	Het
Nalcn	A	T	14: 123,314,105	V1030D	probably damaging	Het
Neb	T	A	2: 52,260,532	I2495F	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nrbf2	G	A	10: 67,267,826	T166M	probably damaging	Het
Nup153	T	C	13: 46,689,181	D837G	probably damaging	Het
Nup210	C	A	6: 91,075,960	G331V	probably damaging	Het
Olfr1143	T	C	2: 87,803,136	L245P	probably damaging	Het
Olfr1447	T	C	19: 12,900,956	T275A	probably benign	Het
Olfr5	A	G	7: 6,481,009		probably null	Het
Olfr923	T	A	9: 38,828,338	S210T	probably benign	Het
Pabpc4	T	A	4: 123,289,059	L163H	probably damaging	Het
Papd5	T	A	8: 88,243,309	M203K	possibly damaging	Het
Pcdh7	T	A	5: 57,721,540	Y126*	probably null	Het
Pdzd2	A	G	15: 12,385,439	S1082P	probably benign	Het
Pkd2l1	T	C	19: 44,150,463	I649M	probably benign	Het
Plcl2	G	A	17: 50,607,729	E589K	probably damaging	Het
Plppr1	C	A	4: 49,337,674	T325N	possibly damaging	Het
Pqlc1	T	G	18: 80,283,314	S126A	probably benign	Het
Prss8	GCTGCCCAAGTCCC	GC	7: 127,929,849		probably benign	Het
Ptcd2	A	G	13: 99,344,597	S25P	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rusc2	T	A	4: 43,416,137	V481E	probably damaging	Het
Sephs2	G	T	7: 127,272,967	T318K	probably damaging	Het
Sf3b1	T	A	1: 55,003,154	I497L	probably damaging	Het
Slc30a7	C	T	3: 115,956,870		probably null	Het
Smarca2	T	C	19: 26,630,828	S96P	probably damaging	Het
Spata31d1c	A	C	13: 65,036,554	I637L	probably benign	Het
Ston2	A	T	12: 91,740,492	S115T	probably damaging	Het
Tal2	A	C	4: 53,785,999	E60A	probably benign	Het
Tdpoz3	A	T	3: 93,826,140	T41S	probably benign	Het
Tespa1	T	C	10: 130,360,691	I166T	probably benign	Het
Thsd7a	A	T	6: 12,555,439	C149S	probably damaging	Het
Trav6-1	T	A	14: 52,638,510		probably benign	Het
Txnl4a	T	C	18: 80,207,264	V25A	probably benign	Het
Utp4	C	A	8: 106,906,276	P297Q	probably benign	Het
Vmn1r34	T	C	6: 66,636,938	Y272C	probably damaging	Het
Vmn2r112	A	T	17: 22,618,486	I643F	probably damaging	Het
Vmn2r121	C	A	X: 124,128,140	G728W	probably damaging	Het
Vmn2r24	T	A	6: 123,786,733	S190T	probably damaging	Het
Zfp507	A	G	7: 35,776,010	V926A	possibly damaging	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
R8725:Cep295	UTSW	9	15332419	nonsense	probably null
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- ACGCTGGCATTCTTCCAGTCAC -3'
(R):5'- CAGCCCTCAACAGAGGATTTGACTC -3'

Sequencing Primer
(F):5'- GGCATTCTTCCAGTCACAATAG -3'
(R):5'- ACAGAGGATTTGACTCCAGCTTG -3'

Posted On

2014-03-17