Incidental Mutation 'R1381:Myof'
ID163069
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 039443-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1381 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37995485 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 124 (Y124H)
Ref Sequence ENSEMBL: ENSMUSP00000129792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000226068]
Predicted Effect probably damaging
Transcript: ENSMUST00000041475
AA Change: Y124H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: Y124H

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172095
AA Change: Y124H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: Y124H

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223650
Predicted Effect probably damaging
Transcript: ENSMUST00000226068
AA Change: Y124H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226084
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,731,086 F252L probably benign Het
Aadac A T 3: 60,039,930 M350L probably damaging Het
Agtrap G A 4: 148,083,965 T19I probably damaging Het
Apba3 C T 10: 81,271,756 T142M possibly damaging Het
Cd55b T A 1: 130,419,675 K133I probably damaging Het
Cep295 A C 9: 15,322,565 C2312G probably benign Het
Ces1a A G 8: 93,034,031 V231A probably damaging Het
Chdh C A 14: 30,036,834 L579I probably damaging Het
Cyb5r4 T A 9: 87,022,233 S19T probably benign Het
Cyp2d22 C A 15: 82,372,508 R355L probably benign Het
Dach2 T C X: 113,298,775 Y117H probably damaging Het
Dennd4c G A 4: 86,774,532 R93K probably benign Het
Dph2 G T 4: 117,889,668 L452I probably damaging Het
Exoc6b T C 6: 84,835,117 D634G probably benign Het
Fam217b G A 2: 178,420,425 V61I probably benign Het
Fbln7 A C 2: 128,877,379 Q32P probably damaging Het
Fgfr1op2 A G 6: 146,588,741 Y46C probably damaging Het
Fhod3 T A 18: 25,090,471 I958N probably damaging Het
Foxp2 T A 6: 15,409,766 M455K possibly damaging Het
Gabrr2 G A 4: 33,081,420 G152D probably damaging Het
Galntl6 G T 8: 58,472,955 P92Q probably damaging Het
Gm5592 A T 7: 41,286,172 T33S probably benign Het
Grid2ip A T 5: 143,362,651 T166S probably benign Het
Grsf1 G A 5: 88,665,864 S225L probably benign Het
Hadha G T 5: 30,128,836 T395K probably benign Het
Hars2 C T 18: 36,789,217 A295V possibly damaging Het
Hsf5 T A 11: 87,638,169 S577T probably benign Het
Ice2 A G 9: 69,400,527 Y31C probably damaging Het
Ift80 A T 3: 68,914,783 I643N possibly damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Ilvbl C A 10: 78,576,596 S50R probably damaging Het
Invs C A 4: 48,421,942 S858* probably null Het
Ipo13 T G 4: 117,904,395 T508P probably damaging Het
Itgb4 T C 11: 115,994,337 I1015T probably benign Het
Kank4 A T 4: 98,779,938 W91R probably damaging Het
Kansl1l C T 1: 66,720,904 A906T probably benign Het
Klk4 G A 7: 43,885,282 V222M probably damaging Het
Lipo4 T A 19: 33,499,341 M336L probably benign Het
Lrig1 T C 6: 94,606,130 N1002D probably benign Het
Lzts3 A G 2: 130,635,299 S524P probably damaging Het
Maz A T 7: 127,023,152 C409* probably null Het
Mmp24 A T 2: 155,814,127 Q495L possibly damaging Het
Mrgpra9 C T 7: 47,235,302 V206I possibly damaging Het
Nalcn A T 14: 123,314,105 V1030D probably damaging Het
Neb T A 2: 52,260,532 I2495F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nup153 T C 13: 46,689,181 D837G probably damaging Het
Nup210 C A 6: 91,075,960 G331V probably damaging Het
Olfr1143 T C 2: 87,803,136 L245P probably damaging Het
Olfr1447 T C 19: 12,900,956 T275A probably benign Het
Olfr5 A G 7: 6,481,009 probably null Het
Olfr923 T A 9: 38,828,338 S210T probably benign Het
Pabpc4 T A 4: 123,289,059 L163H probably damaging Het
Papd5 T A 8: 88,243,309 M203K possibly damaging Het
Pcdh7 T A 5: 57,721,540 Y126* probably null Het
Pdzd2 A G 15: 12,385,439 S1082P probably benign Het
Pkd2l1 T C 19: 44,150,463 I649M probably benign Het
Plcl2 G A 17: 50,607,729 E589K probably damaging Het
Plppr1 C A 4: 49,337,674 T325N possibly damaging Het
Pqlc1 T G 18: 80,283,314 S126A probably benign Het
Prss8 GCTGCCCAAGTCCC GC 7: 127,929,849 probably benign Het
Ptcd2 A G 13: 99,344,597 S25P probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rusc2 T A 4: 43,416,137 V481E probably damaging Het
Sephs2 G T 7: 127,272,967 T318K probably damaging Het
Sf3b1 T A 1: 55,003,154 I497L probably damaging Het
Slc30a7 C T 3: 115,956,870 probably null Het
Smarca2 T C 19: 26,630,828 S96P probably damaging Het
Spata31d1c A C 13: 65,036,554 I637L probably benign Het
Ston2 A T 12: 91,740,492 S115T probably damaging Het
Tal2 A C 4: 53,785,999 E60A probably benign Het
Tdpoz3 A T 3: 93,826,140 T41S probably benign Het
Tespa1 T C 10: 130,360,691 I166T probably benign Het
Thsd7a A T 6: 12,555,439 C149S probably damaging Het
Trav6-1 T A 14: 52,638,510 probably benign Het
Txnl4a T C 18: 80,207,264 V25A probably benign Het
Utp4 C A 8: 106,906,276 P297Q probably benign Het
Vmn1r34 T C 6: 66,636,938 Y272C probably damaging Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Vmn2r121 C A X: 124,128,140 G728W probably damaging Het
Vmn2r24 T A 6: 123,786,733 S190T probably damaging Het
Zfp507 A G 7: 35,776,010 V926A possibly damaging Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCGAGACTGCTCATCACGAGAAC -3'
(R):5'- TGGGGTAAGATAGGCATCGTCCAAC -3'

Sequencing Primer
(F):5'- GCTCATCACGAGAACTGTTTCAC -3'
(R):5'- GATAGGCATCGTCCAACATACC -3'
Posted On2014-03-17