Incidental Mutation 'R1382:Wdr75'
ID163074
Institutional Source Beutler Lab
Gene Symbol Wdr75
Ensembl Gene ENSMUSG00000025995
Gene NameWD repeat domain 75
Synonyms2410118I19Rik, 1300003A18Rik
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location45795166-45823619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45817311 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 498 (Y498C)
Ref Sequence ENSEMBL: ENSMUSP00000027139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027139]
Predicted Effect probably damaging
Transcript: ENSMUST00000027139
AA Change: Y498C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027139
Gene: ENSMUSG00000025995
AA Change: Y498C

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
WD40 185 230 1.61e-3 SMART
WD40 239 275 4.44e0 SMART
WD40 278 317 7.67e0 SMART
low complexity region 405 417 N/A INTRINSIC
WD40 431 473 7.67e0 SMART
WD40 486 524 3.08e0 SMART
WD40 527 568 3.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186308
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Other mutations in Wdr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Wdr75 APN 1 45802075 missense probably benign 0.02
IGL00711:Wdr75 APN 1 45823381 missense probably benign 0.00
IGL01350:Wdr75 APN 1 45818260 nonsense probably null
IGL02135:Wdr75 APN 1 45814563 missense probably damaging 1.00
IGL02135:Wdr75 APN 1 45817448 splice site probably null
BB008:Wdr75 UTSW 1 45819635 missense not run
BB018:Wdr75 UTSW 1 45819635 missense not run
FR4976:Wdr75 UTSW 1 45823404 utr 3 prime probably benign
PIT4378001:Wdr75 UTSW 1 45820173 missense probably damaging 0.98
R0060:Wdr75 UTSW 1 45816617 missense probably benign 0.16
R0463:Wdr75 UTSW 1 45819602 missense probably damaging 1.00
R0963:Wdr75 UTSW 1 45817310 missense probably benign 0.07
R1364:Wdr75 UTSW 1 45799062 missense probably benign 0.01
R1562:Wdr75 UTSW 1 45803870 splice site probably null
R1909:Wdr75 UTSW 1 45823403 missense probably benign 0.00
R2968:Wdr75 UTSW 1 45817341 missense probably damaging 1.00
R3972:Wdr75 UTSW 1 45822554 missense probably benign 0.01
R4372:Wdr75 UTSW 1 45806673 unclassified probably benign
R4720:Wdr75 UTSW 1 45822485 missense probably benign 0.05
R4922:Wdr75 UTSW 1 45816478 missense probably damaging 1.00
R5201:Wdr75 UTSW 1 45823359 missense probably benign 0.00
R5242:Wdr75 UTSW 1 45817327 nonsense probably null
R5255:Wdr75 UTSW 1 45799117 missense probably damaging 1.00
R5320:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R5450:Wdr75 UTSW 1 45812164 missense probably benign 0.26
R6072:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R6147:Wdr75 UTSW 1 45819538 missense probably benign 0.00
R6341:Wdr75 UTSW 1 45802131 critical splice donor site probably null
R6629:Wdr75 UTSW 1 45812056 missense probably damaging 1.00
R6646:Wdr75 UTSW 1 45799087 missense probably damaging 1.00
R6722:Wdr75 UTSW 1 45805352 intron probably null
R6750:Wdr75 UTSW 1 45817379 missense probably damaging 1.00
R6850:Wdr75 UTSW 1 45814598 missense probably benign 0.00
R6851:Wdr75 UTSW 1 45823427 missense probably benign
R7172:Wdr75 UTSW 1 45799134 missense probably damaging 1.00
R7248:Wdr75 UTSW 1 45817400 missense probably damaging 1.00
R7809:Wdr75 UTSW 1 45823436 missense probably benign 0.00
R8171:Wdr75 UTSW 1 45822546 missense probably benign 0.00
R8218:Wdr75 UTSW 1 45818182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCATAAAGGGTTCCTGCC -3'
(R):5'- AACTCACGGGTTACAGCTTCTCAAC -3'

Sequencing Primer
(F):5'- TTCTCCTCCACTAGAGGGAGC -3'
(R):5'- GGGTTACAGCTTCTCAACATTTTG -3'
Posted On2014-03-17