Incidental Mutation 'R1382:Rab3gap1'
ID163079
Institutional Source Beutler Lab
Gene Symbol Rab3gap1
Ensembl Gene ENSMUSG00000036104
Gene NameRAB3 GTPase activating protein subunit 1
Synonyms1700003B17Rik, p130, 4732493F09Rik
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R1382 (G1)
Quality Score107
Status Not validated
Chromosome1
Chromosomal Location127868773-127943868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127942596 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 985 (T985S)
Ref Sequence ENSEMBL: ENSMUSP00000148357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037649] [ENSMUST00000212506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037649
AA Change: T978S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104
AA Change: T978S

DomainStartEndE-ValueType
low complexity region 254 263 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Pfam:Rab3-GTPase_cat 612 769 2.9e-67 PFAM
low complexity region 856 868 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131884
Predicted Effect probably damaging
Transcript: ENSMUST00000212506
AA Change: T985S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal synaptic transmission but have normal gross brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Rab3gap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rab3gap1 APN 1 127930387 splice site probably benign
IGL01467:Rab3gap1 APN 1 127930384 splice site probably null
IGL01554:Rab3gap1 APN 1 127928008 missense possibly damaging 0.82
IGL01773:Rab3gap1 APN 1 127918221 missense possibly damaging 0.64
IGL01866:Rab3gap1 APN 1 127891080 missense probably damaging 1.00
IGL02078:Rab3gap1 APN 1 127868915 splice site probably benign
IGL02251:Rab3gap1 APN 1 127937500 missense probably benign 0.25
IGL02268:Rab3gap1 APN 1 127868958 missense probably damaging 1.00
IGL02274:Rab3gap1 APN 1 127939080 missense probably benign
IGL02372:Rab3gap1 APN 1 127919561 splice site probably benign
IGL02399:Rab3gap1 APN 1 127928103 missense possibly damaging 0.93
IGL02629:Rab3gap1 APN 1 127909863 missense probably benign 0.01
IGL02700:Rab3gap1 APN 1 127938605 missense probably benign 0.06
IGL02748:Rab3gap1 APN 1 127937461 missense probably damaging 0.99
little_bighorn UTSW 1 127891098 critical splice donor site probably null
IGL03048:Rab3gap1 UTSW 1 127937477 missense probably damaging 1.00
R0828:Rab3gap1 UTSW 1 127938185 splice site probably benign
R1729:Rab3gap1 UTSW 1 127942486 missense probably damaging 1.00
R1809:Rab3gap1 UTSW 1 127934514 missense probably damaging 0.99
R1990:Rab3gap1 UTSW 1 127942429 missense possibly damaging 0.56
R2001:Rab3gap1 UTSW 1 127903719 missense possibly damaging 0.95
R2041:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R3955:Rab3gap1 UTSW 1 127934517 missense probably damaging 1.00
R4192:Rab3gap1 UTSW 1 127925470 intron probably benign
R4243:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4244:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4354:Rab3gap1 UTSW 1 127915641 missense probably benign 0.02
R4592:Rab3gap1 UTSW 1 127925259 intron probably benign
R4622:Rab3gap1 UTSW 1 127942419 missense probably benign 0.00
R4738:Rab3gap1 UTSW 1 127934436 missense probably damaging 0.99
R4917:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R4918:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R5090:Rab3gap1 UTSW 1 127915678 missense probably benign 0.35
R5197:Rab3gap1 UTSW 1 127889194 missense probably benign
R5310:Rab3gap1 UTSW 1 127942373 critical splice acceptor site probably null
R5580:Rab3gap1 UTSW 1 127930990 missense probably benign 0.01
R6670:Rab3gap1 UTSW 1 127930775 missense probably benign
R6825:Rab3gap1 UTSW 1 127930421 missense probably damaging 1.00
R7024:Rab3gap1 UTSW 1 127891098 critical splice donor site probably null
R7274:Rab3gap1 UTSW 1 127927512 missense probably benign
R7380:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R7583:Rab3gap1 UTSW 1 127930875 missense probably benign 0.03
R7654:Rab3gap1 UTSW 1 127909915 missense probably damaging 1.00
R8309:Rab3gap1 UTSW 1 127909918 missense possibly damaging 0.82
R8392:Rab3gap1 UTSW 1 127938633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTAAGAAATCAGGCTGCCCAGAG -3'
(R):5'- ACCAGCAAGTGTCCAGAATGTGAG -3'

Sequencing Primer
(F):5'- CTGCCCAGAGGAGAGAAGAC -3'
(R):5'- GATGTGAGGTTCCCCTAACACAG -3'
Posted On2014-03-17