Incidental Mutation 'R1382:Exo1'
ID163080
Institutional Source Beutler Lab
Gene Symbol Exo1
Ensembl Gene ENSMUSG00000039748
Gene Nameexonuclease 1
Synonyms5730442G03Rik, Msa
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location175880581-175913489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175893796 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 334 (T334A)
Ref Sequence ENSEMBL: ENSMUSP00000039376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039725] [ENSMUST00000193822] [ENSMUST00000193858] [ENSMUST00000194306]
Predicted Effect probably damaging
Transcript: ENSMUST00000039725
AA Change: T334A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039376
Gene: ENSMUSG00000039748
AA Change: T334A

DomainStartEndE-ValueType
XPGN 1 99 6.24e-38 SMART
XPGI 138 208 4.56e-31 SMART
HhH2 212 245 2.28e-8 SMART
Blast:XPGI 252 288 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191680
Predicted Effect probably benign
Transcript: ENSMUST00000193822
SMART Domains Protein: ENSMUSP00000141624
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 83 3.5e-11 SMART
XPGI 98 168 1.4e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193858
SMART Domains Protein: ENSMUSP00000141568
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 83 3.5e-11 SMART
XPGI 98 168 1.4e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194306
SMART Domains Protein: ENSMUSP00000141770
Gene: ENSMUSG00000039748

DomainStartEndE-ValueType
XPGN 1 99 2e-40 SMART
XPGI 138 208 1.4e-33 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced life span, lymphoma development, and male/female sterilty due to defective meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Exo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Exo1 APN 1 175896237 missense probably benign 0.00
IGL01116:Exo1 APN 1 175901397 missense possibly damaging 0.76
IGL01766:Exo1 APN 1 175892021 missense possibly damaging 0.67
IGL02117:Exo1 APN 1 175893743 missense possibly damaging 0.60
IGL02979:Exo1 APN 1 175899407 missense probably damaging 1.00
IGL03026:Exo1 APN 1 175908437 makesense probably null
IGL03109:Exo1 APN 1 175899560 missense probably damaging 1.00
IGL03208:Exo1 APN 1 175896245 missense probably benign 0.01
IGL03342:Exo1 APN 1 175892127 missense probably benign 0.09
IGL03147:Exo1 UTSW 1 175888788 missense probably damaging 1.00
R0194:Exo1 UTSW 1 175892030 missense probably damaging 1.00
R0427:Exo1 UTSW 1 175905953 missense probably damaging 0.96
R0520:Exo1 UTSW 1 175899465 missense probably benign 0.00
R1618:Exo1 UTSW 1 175901386 missense probably benign 0.00
R1666:Exo1 UTSW 1 175908486 missense possibly damaging 0.81
R2007:Exo1 UTSW 1 175908530 missense probably damaging 1.00
R2177:Exo1 UTSW 1 175882890 splice site probably null
R2224:Exo1 UTSW 1 175886688 critical splice acceptor site probably null
R2305:Exo1 UTSW 1 175888761 missense probably damaging 1.00
R2509:Exo1 UTSW 1 175905833 missense probably damaging 1.00
R3405:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3406:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3711:Exo1 UTSW 1 175893829 missense probably benign
R3767:Exo1 UTSW 1 175886746 missense probably damaging 1.00
R3787:Exo1 UTSW 1 175899469 missense probably benign
R3853:Exo1 UTSW 1 175892988 missense probably benign 0.01
R5304:Exo1 UTSW 1 175892976 missense probably damaging 1.00
R5625:Exo1 UTSW 1 175893814 missense possibly damaging 0.51
R5869:Exo1 UTSW 1 175901283 missense possibly damaging 0.59
R7013:Exo1 UTSW 1 175893772 missense probably damaging 1.00
R7238:Exo1 UTSW 1 175888847 missense probably damaging 1.00
R7514:Exo1 UTSW 1 175906666 splice site probably null
R7522:Exo1 UTSW 1 175901304 missense probably benign 0.08
R7895:Exo1 UTSW 1 175900996 missense probably benign 0.06
R8218:Exo1 UTSW 1 175900914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTGCTACACCAGGCACAGCATC -3'
(R):5'- GAAGTCATTTTCATGCACGCTCTGC -3'

Sequencing Primer
(F):5'- AGGCTTCCCTTCAAGAAGGTG -3'
(R):5'- tgcacgctctgcatagc -3'
Posted On2014-03-17