Incidental Mutation 'R1382:Gjb3'
ID163084
Institutional Source Beutler Lab
Gene Symbol Gjb3
Ensembl Gene ENSMUSG00000042367
Gene Namegap junction protein, beta 3
SynonymsD4Wsu144e, Gjb-3, Cx31, connexin 31, Cnx31
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1382 (G1)
Quality Score218
Status Not validated
Chromosome4
Chromosomal Location127325235-127330844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127326431 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 103 (R103W)
Ref Sequence ENSEMBL: ENSMUSP00000101697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046532] [ENSMUST00000106091]
Predicted Effect probably damaging
Transcript: ENSMUST00000046532
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046755
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106091
AA Change: R103W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101697
Gene: ENSMUSG00000042367
AA Change: R103W

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 3.47e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 209 3.05e-33 SMART
low complexity region 219 237 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene can cause non-syndromic deafness or erythrokeratodermia variabilis, a skin disorder. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial lethality and transient placental dysmorphogenesis but no impairment in hearing or skin differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Gjb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gjb3 APN 4 127326121 missense probably damaging 0.99
IGL02398:Gjb3 APN 4 127326062 missense probably benign 0.00
IGL02501:Gjb3 APN 4 127326364 missense probably damaging 1.00
IGL02680:Gjb3 APN 4 127326022 missense probably damaging 0.98
R0118:Gjb3 UTSW 4 127326658 missense probably damaging 1.00
R0481:Gjb3 UTSW 4 127326332 missense probably benign 0.00
R1142:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1250:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1279:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1280:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1281:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1282:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1322:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1324:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1325:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1341:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1799:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1834:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R1836:Gjb3 UTSW 4 127326431 missense probably damaging 1.00
R4650:Gjb3 UTSW 4 127326691 missense probably damaging 1.00
R5026:Gjb3 UTSW 4 127326487 missense probably damaging 1.00
R6310:Gjb3 UTSW 4 127326640 missense probably damaging 0.99
R6357:Gjb3 UTSW 4 127326630 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTAGCAATCCACGGTGTTGGGG -3'
(R):5'- CGCATCTGGCTGTCAGTAGTGTTC -3'

Sequencing Primer
(F):5'- TGGCGCACTGTACCAGAC -3'
(R):5'- TCAGTAGTGTTCGTCTTCCG -3'
Posted On2014-03-17