Incidental Mutation 'R1382:Lrrc8b'
ID163086
Institutional Source Beutler Lab
Gene Symbol Lrrc8b
Ensembl Gene ENSMUSG00000070639
Gene Nameleucine rich repeat containing 8 family, member B
SynonymsR75581
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105415775-105490074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105480883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 365 (D365G)
Ref Sequence ENSEMBL: ENSMUSP00000108327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112707]
Predicted Effect probably damaging
Transcript: ENSMUST00000112707
AA Change: D365G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108327
Gene: ENSMUSG00000070639
AA Change: D365G

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 334 2.9e-133 PFAM
LRR 509 536 5.27e1 SMART
LRR 584 607 2.03e1 SMART
LRR 632 654 1.97e1 SMART
LRR_TYP 655 678 4.79e-3 SMART
LRR 679 700 3.09e1 SMART
LRR_TYP 701 724 4.17e-3 SMART
LRR 747 770 2.17e-1 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Lrrc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Lrrc8b APN 5 105480499 missense probably damaging 0.96
IGL00519:Lrrc8b APN 5 105481725 missense possibly damaging 0.82
IGL01732:Lrrc8b APN 5 105485960 missense probably damaging 1.00
IGL01799:Lrrc8b APN 5 105485891 missense probably benign
IGL02005:Lrrc8b APN 5 105481054 missense probably benign 0.22
IGL02205:Lrrc8b APN 5 105481837 missense probably benign 0.07
IGL03038:Lrrc8b APN 5 105481492 missense probably damaging 0.98
IGL03076:Lrrc8b APN 5 105481549 missense probably damaging 1.00
IGL02796:Lrrc8b UTSW 5 105481345 missense probably damaging 1.00
R0647:Lrrc8b UTSW 5 105480607 missense possibly damaging 0.69
R0722:Lrrc8b UTSW 5 105480112 missense possibly damaging 0.89
R1437:Lrrc8b UTSW 5 105481702 missense probably damaging 1.00
R1801:Lrrc8b UTSW 5 105480823 missense probably damaging 1.00
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R2169:Lrrc8b UTSW 5 105481887 missense probably damaging 0.99
R4514:Lrrc8b UTSW 5 105479953 missense probably damaging 1.00
R4898:Lrrc8b UTSW 5 105480214 missense probably benign 0.19
R5243:Lrrc8b UTSW 5 105480946 missense probably damaging 1.00
R5264:Lrrc8b UTSW 5 105480252 missense probably damaging 0.98
R5424:Lrrc8b UTSW 5 105480703 missense probably damaging 1.00
R5513:Lrrc8b UTSW 5 105485984 missense probably damaging 1.00
R5632:Lrrc8b UTSW 5 105480297 missense possibly damaging 0.81
R5799:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R5800:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R6637:Lrrc8b UTSW 5 105480271 missense possibly damaging 0.80
R7249:Lrrc8b UTSW 5 105481267 missense probably benign 0.23
R7253:Lrrc8b UTSW 5 105481656 missense probably benign 0.01
R7558:Lrrc8b UTSW 5 105481711 missense probably damaging 1.00
R8077:Lrrc8b UTSW 5 105480017 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCGACGTGCAGGCATTTACAGG -3'
(R):5'- AGCATGAAGAGATGCAGCTCGACC -3'

Sequencing Primer
(F):5'- CAGGCATTTACAGGCTATAAGC -3'
(R):5'- AGATGCAGCTCGACCTTGTC -3'
Posted On2014-03-17