Incidental Mutation 'R1382:Olfr638'
ID163090
Institutional Source Beutler Lab
Gene Symbol Olfr638
Ensembl Gene ENSMUSG00000094063
Gene Nameolfactory receptor 638
SynonymsMOR5-1, GA_x6K02T2PBJ9-6737723-6738670
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1382 (G1)
Quality Score163
Status Not validated
Chromosome7
Chromosomal Location103998746-104004357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104003720 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 148 (L148F)
Ref Sequence ENSEMBL: ENSMUSP00000151996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138055] [ENSMUST00000209757] [ENSMUST00000215653] [ENSMUST00000218325]
Predicted Effect probably benign
Transcript: ENSMUST00000098184
AA Change: L154F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000095786
Gene: ENSMUSG00000094063
AA Change: L154F

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 2.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 198 9.8e-10 PFAM
Pfam:7tm_1 49 300 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209757
AA Change: L154F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215653
Predicted Effect probably benign
Transcript: ENSMUST00000218325
AA Change: L148F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Olfr638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Olfr638 APN 7 104003635 missense probably damaging 1.00
IGL01901:Olfr638 APN 7 104004067 missense probably damaging 1.00
IGL02040:Olfr638 APN 7 104003407 missense probably damaging 1.00
IGL02756:Olfr638 APN 7 104003659 missense probably damaging 1.00
R0122:Olfr638 UTSW 7 104003358 missense probably damaging 1.00
R0137:Olfr638 UTSW 7 104003502 missense probably benign 0.13
R0312:Olfr638 UTSW 7 104004025 missense probably damaging 1.00
R0650:Olfr638 UTSW 7 104003239 splice site probably null
R0652:Olfr638 UTSW 7 104003239 splice site probably null
R1700:Olfr638 UTSW 7 104004122 nonsense probably null
R1723:Olfr638 UTSW 7 104003311 missense probably damaging 0.97
R1745:Olfr638 UTSW 7 104004063 missense probably benign 0.02
R1840:Olfr638 UTSW 7 104004117 missense probably benign 0.00
R3408:Olfr638 UTSW 7 104003343 nonsense probably null
R3413:Olfr638 UTSW 7 104003832 missense probably damaging 0.99
R4441:Olfr638 UTSW 7 104004072 missense probably damaging 1.00
R4727:Olfr638 UTSW 7 104003890 missense probably benign 0.00
R5096:Olfr638 UTSW 7 104003460 missense probably benign 0.08
R5851:Olfr638 UTSW 7 104003452 missense probably benign 0.13
R6133:Olfr638 UTSW 7 104003325 missense possibly damaging 0.58
R6529:Olfr638 UTSW 7 104003926 missense probably benign 0.06
R6572:Olfr638 UTSW 7 103999184 intron probably null
R6799:Olfr638 UTSW 7 103998799 critical splice donor site probably null
R7267:Olfr638 UTSW 7 104003839 missense probably benign
X0018:Olfr638 UTSW 7 104003431 missense probably benign
X0063:Olfr638 UTSW 7 104003527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTGCTTTGCACAGGTATTCTTC -3'
(R):5'- CGTTCAGTCCAAGTGGCTGTGTTC -3'

Sequencing Primer
(F):5'- TTGACCGTTATGTGGCCATC -3'
(R):5'- CAGGACACTTTTCAGGATAAGTGC -3'
Posted On2014-03-17