Incidental Mutation 'R1382:Ppan'
ID163094
Institutional Source Beutler Lab
Gene Symbol Ppan
Ensembl Gene ENSMUSG00000004100
Gene Namepeter pan homolog
SynonymsSSF1, A230087P06Rik
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1382 (G1)
Quality Score207
Status Not validated
Chromosome9
Chromosomal Location20888175-20892178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20891918 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 429 (K429E)
Ref Sequence ENSEMBL: ENSMUSP00000004203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004203] [ENSMUST00000004206] [ENSMUST00000214331]
Predicted Effect probably benign
Transcript: ENSMUST00000004203
AA Change: K429E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000004203
Gene: ENSMUSG00000004100
AA Change: K429E

DomainStartEndE-ValueType
Brix 32 286 1.13e-77 SMART
Blast:Brix 321 429 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000004206
SMART Domains Protein: ENSMUSP00000004206
Gene: ENSMUSG00000070319

DomainStartEndE-ValueType
Pfam:eIF3g 56 175 5.5e-45 PFAM
RRM 240 313 1.49e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213882
Predicted Effect probably benign
Transcript: ENSMUST00000214331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216133
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an evolutionarily conserved protein similar to yeast SSF1 as well as to the gene product of the Drosophila gene peter pan (ppan). SSF1 is known to be involved in the second step of mRNA splicing. Both SSF1 and ppan are essential for cell growth and proliferation. Exogenous expression of this gene was reported to reduce the anchorage-independent growth of some tumor cells. Read-through transcription of this gene with P2RY11/P2Y(11), an adjacent downstream gene that encodes an ATP receptor, has been found. These read-through transcripts are ubiquitously present and up-regulated during granulocyte differentiation. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Ppan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Ppan APN 9 20890936 missense probably damaging 1.00
IGL03162:Ppan APN 9 20891312 missense probably damaging 1.00
R0279:Ppan UTSW 9 20891529 missense probably benign 0.01
R4406:Ppan UTSW 9 20890992 missense probably damaging 1.00
R4724:Ppan UTSW 9 20888510 missense probably benign 0.04
R5217:Ppan UTSW 9 20890925 missense possibly damaging 0.46
R5275:Ppan UTSW 9 20889773 nonsense probably null
R5946:Ppan UTSW 9 20889673 nonsense probably null
R6540:Ppan UTSW 9 20891210 splice site probably null
R7131:Ppan UTSW 9 20891154 missense possibly damaging 0.94
R7227:Ppan UTSW 9 20888200 unclassified probably benign
R7419:Ppan UTSW 9 20891844 missense probably benign 0.03
R7883:Ppan UTSW 9 20891481 missense probably benign 0.24
R7966:Ppan UTSW 9 20891481 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ATGACGCTGAGTATTTCCGCCAGG -3'
(R):5'- GGGCAGACATAATCCTCACAGCAG -3'

Sequencing Primer
(F):5'- ATTTCCGCCAGGCTGTG -3'
(R):5'- ACTGCTAGTCAGTGTGACACC -3'
Posted On2014-03-17