Incidental Mutation 'R1382:Gm17727'
ID163095
Institutional Source Beutler Lab
Gene Symbol Gm17727
Ensembl Gene ENSMUSG00000090738
Gene Namepredicted gene, 17727
Synonyms
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35776524-35778109 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 35778094 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171898] [ENSMUST00000184431]
Predicted Effect probably benign
Transcript: ENSMUST00000171898
SMART Domains Protein: ENSMUSP00000129553
Gene: ENSMUSG00000090738

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184431
AA Change: K64M
SMART Domains Protein: ENSMUSP00000139380
Gene: ENSMUSG00000098847
AA Change: K64M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Gm17727
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Gm17727 APN 9 35776748 missense possibly damaging 0.73
IGL02044:Gm17727 APN 9 35776663 missense probably benign 0.19
IGL02352:Gm17727 APN 9 35777884 start codon destroyed probably null 0.04
IGL02359:Gm17727 APN 9 35777884 start codon destroyed probably null 0.04
R0827:Gm17727 UTSW 9 35777851 missense probably damaging 0.97
R1591:Gm17727 UTSW 9 35776656 missense probably damaging 0.99
R1794:Gm17727 UTSW 9 35777122 missense probably benign 0.01
R5419:Gm17727 UTSW 9 35778111 unclassified probably null
R6110:Gm17727 UTSW 9 35777146 missense possibly damaging 0.90
R6379:Gm17727 UTSW 9 35778085 start gained probably benign
R6614:Gm17727 UTSW 9 35777125 missense probably damaging 0.99
R7698:Gm17727 UTSW 9 35777176 missense probably benign 0.27
R7833:Gm17727 UTSW 9 35777110 missense probably damaging 1.00
R7916:Gm17727 UTSW 9 35777110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGCAGAACGATGCTCAGCTCC -3'
(R):5'- CAGTTCACCTCATGGTGACTGTCC -3'

Sequencing Primer
(F):5'- CCATTGAGGATTTGCTAACTCTTG -3'
(R):5'- TCATGGTGACTGTCCACTTTC -3'
Posted On2014-03-17