Incidental Mutation 'R1382:Lemd3'
ID163098
Institutional Source Beutler Lab
Gene Symbol Lemd3
Ensembl Gene ENSMUSG00000048661
Gene NameLEM domain containing 3
SynonymsMan1
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location120923413-120979332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120931736 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 711 (I711K)
Ref Sequence ENSEMBL: ENSMUSP00000113103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119093] [ENSMUST00000119944]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118291
Predicted Effect probably damaging
Transcript: ENSMUST00000119093
AA Change: I733K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112661
Gene: ENSMUSG00000048661
AA Change: I733K

DomainStartEndE-ValueType
LEM 8 51 1.01e-20 SMART
low complexity region 66 87 N/A INTRINSIC
low complexity region 106 129 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 169 176 N/A INTRINSIC
low complexity region 195 229 N/A INTRINSIC
low complexity region 258 272 N/A INTRINSIC
low complexity region 346 355 N/A INTRINSIC
low complexity region 366 384 N/A INTRINSIC
low complexity region 418 429 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Pfam:MSC 526 779 8.9e-25 PFAM
PDB:4OZ1|B 812 919 2e-23 PDB
SCOP:d1jmta_ 813 894 6e-7 SMART
Blast:RRM 814 893 4e-49 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119944
AA Change: I711K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113103
Gene: ENSMUSG00000048661
AA Change: I711K

DomainStartEndE-ValueType
LEM 8 51 1.01e-20 SMART
low complexity region 66 87 N/A INTRINSIC
low complexity region 106 129 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 169 176 N/A INTRINSIC
low complexity region 195 229 N/A INTRINSIC
low complexity region 258 272 N/A INTRINSIC
low complexity region 346 355 N/A INTRINSIC
low complexity region 366 384 N/A INTRINSIC
low complexity region 418 429 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Pfam:MSC 518 758 5.7e-57 PFAM
PDB:4OZ1|B 790 897 2e-23 PDB
SCOP:d1jmta_ 791 872 5e-7 SMART
Blast:RRM 792 871 4e-49 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a LEM domain-containing protein. The encoded protein functions to antagonize transforming growth factor-beta signaling at the inner nuclear membrane. Two transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been associated with osteopoikilosis, Buschke-Ollendorff syndrome and melorheostosis.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at midgestation, defects in vascular remodeling and increased apoptosis in embryos, particularly in mesenchymal tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Lemd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Lemd3 APN 10 120933399 nonsense probably null
IGL01733:Lemd3 APN 10 120933663 nonsense probably null
IGL02127:Lemd3 APN 10 120926028 missense possibly damaging 0.58
IGL02171:Lemd3 APN 10 120933622 splice site probably benign
Culebra UTSW 10 120933633 missense probably damaging 1.00
R0037:Lemd3 UTSW 10 120925456 missense possibly damaging 0.95
R0309:Lemd3 UTSW 10 120937110 missense possibly damaging 0.71
R0829:Lemd3 UTSW 10 120979083 missense probably benign
R1171:Lemd3 UTSW 10 120949341 missense possibly damaging 0.90
R1954:Lemd3 UTSW 10 120978940 missense probably damaging 0.99
R2044:Lemd3 UTSW 10 120933442 missense probably damaging 1.00
R2197:Lemd3 UTSW 10 120978527 small deletion probably benign
R3118:Lemd3 UTSW 10 120947251 missense probably benign 0.00
R3697:Lemd3 UTSW 10 120978527 small deletion probably benign
R3729:Lemd3 UTSW 10 120928015 missense probably damaging 1.00
R4407:Lemd3 UTSW 10 120925430 missense possibly damaging 0.93
R4429:Lemd3 UTSW 10 120977988 missense probably benign 0.00
R4830:Lemd3 UTSW 10 120931948 missense probably damaging 0.99
R5316:Lemd3 UTSW 10 120952256 critical splice acceptor site probably null
R5355:Lemd3 UTSW 10 120933633 missense probably damaging 1.00
R5404:Lemd3 UTSW 10 120931958 nonsense probably null
R6754:Lemd3 UTSW 10 120933660 missense probably damaging 1.00
R7007:Lemd3 UTSW 10 120952232 missense probably benign 0.28
R7213:Lemd3 UTSW 10 120978240 nonsense probably null
R7699:Lemd3 UTSW 10 120978090 missense probably damaging 0.99
R7700:Lemd3 UTSW 10 120978090 missense probably damaging 0.99
R7781:Lemd3 UTSW 10 120925773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTACTAGACTGAGAAGCCGTACC -3'
(R):5'- TAACGCCGACCCCAAATGTTGC -3'

Sequencing Primer
(F):5'- GCCGTACCTTGCAGAATATG -3'
(R):5'- GCTCTCCGGTACATGAGATAC -3'
Posted On2014-03-17