Incidental Mutation 'R1382:Cuedc1'
ID163100
Institutional Source Beutler Lab
Gene Symbol Cuedc1
Ensembl Gene ENSMUSG00000018378
Gene NameCUE domain containing 1
SynonymsC330016O16Rik
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1382 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location88098058-88194140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88177363 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 146 (P146S)
Ref Sequence ENSEMBL: ENSMUSP00000120867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018522] [ENSMUST00000154812]
Predicted Effect probably benign
Transcript: ENSMUST00000018522
AA Change: P146S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018522
Gene: ENSMUSG00000018378
AA Change: P146S

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
low complexity region 331 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133149
Predicted Effect probably benign
Transcript: ENSMUST00000154812
AA Change: P146S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120867
Gene: ENSMUSG00000018378
AA Change: P146S

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Cuedc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Cuedc1 APN 11 88183254 missense possibly damaging 0.56
IGL02103:Cuedc1 APN 11 88188799 missense probably damaging 0.99
IGL02325:Cuedc1 APN 11 88170173 missense probably null 1.00
IGL03001:Cuedc1 APN 11 88182489 missense probably benign 0.02
IGL03245:Cuedc1 APN 11 88177262 splice site probably benign
R0242:Cuedc1 UTSW 11 88184621 splice site probably benign
R0511:Cuedc1 UTSW 11 88183405 missense probably damaging 1.00
R1013:Cuedc1 UTSW 11 88188027 missense possibly damaging 0.68
R2004:Cuedc1 UTSW 11 88177390 missense probably damaging 1.00
R5320:Cuedc1 UTSW 11 88177310 missense probably damaging 1.00
R5381:Cuedc1 UTSW 11 88187986 splice site probably null
R5782:Cuedc1 UTSW 11 88170032 missense probably damaging 1.00
R6282:Cuedc1 UTSW 11 88183402 missense probably damaging 1.00
R6918:Cuedc1 UTSW 11 88187073 missense probably benign 0.00
R7329:Cuedc1 UTSW 11 88169866 missense unknown
R8289:Cuedc1 UTSW 11 88182555 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTAGCTCCTAGCAGCAATGCAC -3'
(R):5'- TGTCCCGTGAAAATGTCTCTTGCC -3'

Sequencing Primer
(F):5'- ATCCCAATGCCACTGAGGTTC -3'
(R):5'- GTGAAAATGTCTCTTGCCACAGTC -3'
Posted On2014-03-17