Incidental Mutation 'R1382:Prl2c2'
ID163104
Institutional Source Beutler Lab
Gene Symbol Prl2c2
Ensembl Gene ENSMUSG00000079092
Gene Nameprolactin family 2, subfamily c, member 2
SynonymsPlf, Plf1, MRP-1, PLF-1
MMRRC Submission 039444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1382 (G1)
Quality Score149
Status Not validated
Chromosome13
Chromosomal Location12996125-13005383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13002201 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 47 (T47R)
Ref Sequence ENSEMBL: ENSMUSP00000152538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110594] [ENSMUST00000220558] [ENSMUST00000221612] [ENSMUST00000221627]
Predicted Effect probably damaging
Transcript: ENSMUST00000110594
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106224
Gene: ENSMUSG00000079092
AA Change: T47R

DomainStartEndE-ValueType
Pfam:Hormone_1 16 224 9.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220558
AA Change: T45R

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000221612
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000221627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223124
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,127,040 C236Y probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Asap2 A G 12: 21,265,954 T916A probably damaging Het
Ceacam5 T C 7: 17,752,165 V529A probably benign Het
Cep192 G A 18: 67,856,299 R1839Q possibly damaging Het
Cope A G 8: 70,312,863 N295S probably benign Het
Crocc2 G A 1: 93,217,093 probably null Het
Cuedc1 C T 11: 88,177,363 P146S probably benign Het
Ddc T C 11: 11,824,856 D345G possibly damaging Het
Dsg4 T A 18: 20,465,124 C700S probably benign Het
Dst A T 1: 34,268,833 E6224D probably damaging Het
Exo1 A G 1: 175,893,796 T334A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm17727 T A 9: 35,778,094 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lemd3 A T 10: 120,931,736 I711K probably damaging Het
Lrrc8b A G 5: 105,480,883 D365G probably damaging Het
Mdga2 A T 12: 66,470,916 I48K possibly damaging Het
Olfr638 G T 7: 104,003,720 L148F probably benign Het
Pdzph1 A G 17: 58,974,747 V180A probably benign Het
Phactr1 T C 13: 43,132,975 F584S probably damaging Het
Ppan A G 9: 20,891,918 K429E probably benign Het
Prkd3 A G 17: 78,957,245 V647A probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptpru A G 4: 131,808,229 F407S probably damaging Het
Rab3gap1 A T 1: 127,942,596 T985S probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tet2 C T 3: 133,476,615 G1196D probably damaging Het
Tub G A 7: 109,030,153 V426I probably damaging Het
Wdr75 A G 1: 45,817,311 Y498C probably damaging Het
Other mutations in Prl2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Prl2c2 APN 13 13002243 missense probably damaging 1.00
R0991:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R0993:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1139:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1196:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1250:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1319:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1321:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1325:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1341:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1415:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1494:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1878:Prl2c2 UTSW 13 13005326 start codon destroyed probably damaging 0.99
R1950:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1983:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1999:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R3704:Prl2c2 UTSW 13 13002225 missense probably damaging 0.99
R4972:Prl2c2 UTSW 13 13002170 missense possibly damaging 0.74
R6170:Prl2c2 UTSW 13 13002172 missense probably damaging 0.99
R6766:Prl2c2 UTSW 13 13002128 splice site probably null
R7426:Prl2c2 UTSW 13 12997480 splice site probably null
R7635:Prl2c2 UTSW 13 12997343 missense probably damaging 0.98
R7842:Prl2c2 UTSW 13 13005322 missense probably benign 0.13
R7925:Prl2c2 UTSW 13 13005322 missense probably benign 0.13
X0065:Prl2c2 UTSW 13 13002175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTTTCTGCTTTAGGCTATGCACTA -3'
(R):5'- TCAGCACCCTGCCTTGAATCAAAT -3'

Sequencing Primer
(F):5'- CTATATCAACCATTGTGTTGGAGGC -3'
(R):5'- caaaacaaccaaccaaccaac -3'
Posted On2014-03-17